Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: QF#7m1
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46116 Copy
Species: Synthetic
Genetic Insert: QFAD184-214
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.
Proper citation: RRID:Addgene_46117 Copy
Species: Gallus gallus
Genetic Insert: Vcl 884-1066
Vector Backbone Description: Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: YFP subcloned into 15b/V884-1066 (Addgene plasmid 46176) via a PCR strategy which placed Nde sites at the ends of the YFP cDNA and added the spacer region in EGFPC1/V1-1066 at the Cterminus of YFP.
Proper citation: RRID:Addgene_46181 Copy
Species: Homo sapiens
Genetic Insert: Depdc5
Vector Backbone Description: Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46336 Copy
Species: Homo sapiens
Genetic Insert: Seh1
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46331 Copy
Species: Homo sapiens
Genetic Insert: PSD95.FingR-eGFP-CCR5TC
Vector Backbone Description: Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23791193
Proper citation: RRID:Addgene_46295 Copy
Species: Homo sapiens
Genetic Insert: GPHN.FingR-eGFP-CCR5TC
Vector Backbone Description: Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23791193
Proper citation: RRID:Addgene_46296 Copy
Species: Homo sapiens
Genetic Insert: Depdc5
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23723238
Proper citation: RRID:Addgene_46327 Copy
Species: Homo sapiens
Genetic Insert: SFPQ
Vector Backbone Description: Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22966205
Comments: There is a stop codon before HIS tag in the vector.
Proper citation: RRID:Addgene_46320 Copy
Species: Homo sapiens
Genetic Insert: HeLa long myosin light chain kinase
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15020676
Proper citation: RRID:Addgene_46316 Copy
Species: Homo sapiens
Genetic Insert: HeLa long myosin light chain kinase-dead
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15020676
Proper citation: RRID:Addgene_46317 Copy
Species: Mus musculus
Genetic Insert: Vimentin
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19726676
Proper citation: RRID:Addgene_46315 Copy
Species: Tomato bushy stunt virus
Genetic Insert: p19
Vector Backbone Description: Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23475073
Proper citation: RRID:Addgene_46306 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(-)B/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18320585
Comments: EWS cDNA was amplified by PCR using XhoI-NotI-forward and EcoRI-reverse primers 5-TCTCTCGAGCG
GCCGCGCCACCATGGCGTCCACGGATTACAGTACC-3
5-CCGAATTCGTAGGGCCGATCTCTGCGCTCCTG-3, respectively.
Proper citation: RRID:Addgene_46386 Copy
Species: Homo sapiens
Genetic Insert: EWSR1
Vector Backbone Description: Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6p-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16044463
Comments: The EWS cDNA23 was PCR-amplified using primers
ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG.
Proper citation: RRID:Addgene_46384 Copy
Species: Homo sapiens
Genetic Insert: Blnk
Vector Backbone Description: Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17588523
Comments: The molecular weight of the GST fusion protein is approximately 39.5 kDa
Proper citation: RRID:Addgene_46408 Copy
Species: E. coli
Genetic Insert: Streptavidin-Glutamate_Tag
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056174
Proper citation: RRID:Addgene_46367 Copy
Vector Backbone Description: Vector Backbone:pUC/2 micrometer plasmid; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24058528
Proper citation: RRID:Addgene_46365 Copy
Species: Homo sapiens
Genetic Insert: EB1
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23870127
Proper citation: RRID:Addgene_46364 Copy
Species: Homo sapiens
Genetic Insert: 4.1G C-terminal domain
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23870127
Comments: Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI
Proper citation: RRID:Addgene_46362 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
