Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pattB-synaptobrevin-7m1-QFBDADM1-hsp70 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46116 | QF#7m1 | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:26 | 3 | |
|
pattB-synaptobrevin-8-QFAD184-214-hsp70 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46117 | QFAD184-214 | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Backbone Size:7400; Vector Backbone:pattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:26 | 1 | |
|
pET15b/EYFP-GgVcl 884-1066 (Vt) Resource Report Resource Website 1+ mentions |
RRID:Addgene_46181 | Vcl 884-1066 | Gallus gallus | Ampicillin | YFP subcloned into 15b/V884-1066 (Addgene plasmid 46176) via a PCR strategy which placed Nde sites at the ends of the YFP cDNA and added the spacer region in EGFPC1/V1-1066 at the Cterminus of YFP. | Backbone Marker:EMD; Backbone Size:5700; Vector Backbone:pET-15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | aa 884-1066 (tail domain) | 2026-09-01 09:55:27 | 1 | |
|
Flag Depdc5 pLJM1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46336 | Depdc5 | Homo sapiens | Ampicillin | PMID:23723238 | Vector Backbone:pLJM1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | Differs from Depdc5 isoform 1 by 10 amino acids starting at position 724: ILTLSAPPVV | 2026-09-01 09:55:28 | 1 | |
|
HA Seh1L pRK5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46331 | Seh1 | Homo sapiens | Ampicillin | PMID:23723238 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:28 | 2 | ||
|
pCAG_PSD95.FingR-eGFP-CCR5TC Resource Report Resource Website 10+ mentions |
RRID:Addgene_46295 | PSD95.FingR-eGFP-CCR5TC | Homo sapiens | Ampicillin | PMID:23791193 | Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:28 | 35 | ||
|
pCAG_GPHN.FingR-eGFP-CCR5TC Resource Report Resource Website 10+ mentions |
RRID:Addgene_46296 | GPHN.FingR-eGFP-CCR5TC | Homo sapiens | Ampicillin | PMID:23791193 | Backbone Size:4113; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:28 | 22 | ||
|
HA Depdc5 pRK5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46327 | Depdc5 | Homo sapiens | Ampicillin | PMID:23723238 | Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Differs from Depdc5 isoform 1 by 10 amino acids starting at position 724: ILTLSAPPVV | 2026-09-01 09:55:28 | 3 | |
|
pSCT-GAL93-SFPQ Resource Report Resource Website 1+ mentions |
RRID:Addgene_46320 | SFPQ | Homo sapiens | Ampicillin | PMID:22966205 | There is a stop codon before HIS tag in the vector. | Backbone Marker:Brown lab (Addgene plasmid 46339); Vector Backbone:pSCT-GAL93-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:28 | 1 | |
|
HeLa full-length MLCK-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46316 | HeLa long myosin light chain kinase | Homo sapiens | Kanamycin | PMID:15020676 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:55:28 | 2 | ||
|
Hela kinase-dead MLCK-GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_46317 | HeLa long myosin light chain kinase-dead | Homo sapiens | Kanamycin | PMID:15020676 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin | E1626K | 2026-09-01 09:55:28 | 3 | |
|
HA-Vim Resource Report Resource Website 1+ mentions |
RRID:Addgene_46315 | Vimentin | Mus musculus | Ampicillin | PMID:19726676 | Backbone Marker:Clontech; Backbone Size:3800; Vector Backbone:pCMV-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:28 | 1 | ||
|
pGEX-4T-1-p19-T7 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46306 | p19 | Tomato bushy stunt virus | Ampicillin | PMID:23475073 | Backbone Size:4941; Vector Backbone:pGEX-4T-1; Vector Types:Bacterial Expression, pro-siRNA; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:28 | 1 | ||
|
pcDNA3.1 EWS-myc-HIS Resource Report Resource Website 1+ mentions |
RRID:Addgene_46386 | EWSR1 | Homo sapiens | Ampicillin | PMID:18320585 | EWS cDNA was amplified by PCR using XhoI-NotI-forward and EcoRI-reverse primers 5-TCTCTCGAGCG GCCGCGCCACCATGGCGTCCACGGATTACAGTACC-3 5-CCGAATTCGTAGGGCCGATCTCTGCGCTCCTG-3, respectively. | Backbone Marker:Invitrogen; Backbone Size:5500; Vector Backbone:pcDNA3.1(-)B/myc-His; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:29 | 1 | |
|
pGEX-6p-2-EWSR1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46384 | EWSR1 | Homo sapiens | Ampicillin | PMID:16044463 | The EWS cDNA23 was PCR-amplified using primers ATCTGGAATTCAAATGGCGTCCACGGATTACAGTACCTATAGCCAAGCTGCAGC and CTGGTAGTCAATGCAGCTCGAGGGGGTCTCTGCATCTAGTAGG. | Backbone Marker:Amersham; Backbone Size:4900; Vector Backbone:pGEX-6p-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:29 | 1 | |
|
pGEX Blnk-SH2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46408 | Blnk | Homo sapiens | Ampicillin | PMID:17588523 | The molecular weight of the GST fusion protein is approximately 39.5 kDa | Backbone Marker:GE Healthcare Biosciences; Backbone Size:4900; Vector Backbone:pGEX6P1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains amino acids 333-456 | 2026-09-01 09:55:30 | 2 |
|
pET21-Streptavidin-Glutamate_Tag Resource Report Resource Website 10+ mentions |
RRID:Addgene_46367 | Streptavidin-Glutamate_Tag | E. coli | Ampicillin | PMID:24056174 | Backbone Marker:Novagen; Backbone Size:5400; Vector Backbone:pET21; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:29 | 14 | ||
|
pRTVIR Resource Report Resource Website 1+ mentions |
RRID:Addgene_46365 | Ampicillin | PMID:24058528 | Vector Backbone:pUC/2 micrometer plasmid; Vector Types:; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:29 | 1 | ||||
|
pCB150-2_GFP-EB1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_46364 | EB1 | Homo sapiens | Ampicillin | PMID:23870127 | Backbone Size:6000; Vector Backbone:pBABE; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:29 | 1 | ||
|
pTK165_Mem-mCherry-4.1G-CTD Resource Report Resource Website 1+ mentions |
RRID:Addgene_46362 | 4.1G C-terminal domain | Homo sapiens | Kanamycin | PMID:23870127 | Neuromodulin N-terminal sequence is MLCCMRRTKQVEKNDDDQKI | Backbone Size:4000; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | C-terminal domain from 886-1005 amino acids | 2026-09-01 09:55:29 | 3 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.