Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 460 showing 9181 ~ 9200 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/174917

Species: M. smegmatis
Genetic Insert: MSMEG_0791
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174917 Copy   


http://www.addgene.org/174918

Species: M. smegmatis
Genetic Insert: MSMEG_0793
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174918 Copy   


http://www.addgene.org/174919

Species: M. smegmatis
Genetic Insert: MSMEG_0775
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174919 Copy   


http://www.addgene.org/174914

Species: M. smegmatis
Genetic Insert: MSMEG_0786
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174914 Copy   


http://www.addgene.org/174915

Species: M. smegmatis
Genetic Insert: MSMEG_0787
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174915 Copy   


  • RRID:Addgene_174907

http://www.addgene.org/174907

Species: Homo sapiens
Genetic Insert: Specificity Protein 1
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:14873; Vector Backbone:pLentiCRISPRv2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33730584

Proper citation: RRID:Addgene_174907 Copy   


  • RRID:Addgene_174862

    This resource has 1+ mentions.

http://www.addgene.org/174862

Species: Mus musculus
Genetic Insert: Cre flanked by MmPeg10 UTRs
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34413232

Proper citation: RRID:Addgene_174862 Copy   


  • RRID:Addgene_174863

http://www.addgene.org/174863

Species: Homo sapiens
Genetic Insert: Cre flanked by HsPeg10 UTRs
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34413232

Proper citation: RRID:Addgene_174863 Copy   


http://www.addgene.org/174938

Species: M. smegmatis
Genetic Insert: MSMEG_0924
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174938 Copy   


http://www.addgene.org/174932

Species: M. smegmatis
Genetic Insert: MSMEG_0909
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174932 Copy   


http://www.addgene.org/174933

Species: M. smegmatis
Genetic Insert: MSMEG_0912
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174933 Copy   


http://www.addgene.org/174936

Species: M. smegmatis
Genetic Insert: MSMEG_0919
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174936 Copy   


http://www.addgene.org/174937

Species: M. smegmatis
Genetic Insert: MSMEG_0922
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174937 Copy   


http://www.addgene.org/174890

Species: Methanosarcina mazei
Genetic Insert: Mma PylRS
Vector Backbone Description: Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34431592

Proper citation: RRID:Addgene_174890 Copy   


http://www.addgene.org/174927

Species: M. smegmatis
Genetic Insert: MSMEG_0876
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174927 Copy   


http://www.addgene.org/174928

Species: M. smegmatis
Genetic Insert: MSMEG_0880
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174928 Copy   


  • RRID:Addgene_174888

http://www.addgene.org/174888

Species: Saccharomyces cerevisiae
Genetic Insert: Met4 UIML
Vector Backbone Description: Vector Backbone:pet28(a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34763062

Proper citation: RRID:Addgene_174888 Copy   


http://www.addgene.org/174922

Species: M. smegmatis
Genetic Insert: MSMEG_0833
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)

Proper citation: RRID:Addgene_174922 Copy   


http://www.addgene.org/17491

Genetic Insert: Firefly Luciferase shRNA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7602; Vector Backbone:pQCXIP; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Comments: shRNA oligo sequence - 5'-CCTTACGCTGAGTACTTCGAGTGTGCTGTCCTCGAAGTACTCAGCGTAAGTTT

Proper citation: RRID:Addgene_17491 Copy   


http://www.addgene.org/17492

Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Size:8477; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394

Proper citation: RRID:Addgene_17492 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X