Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: M. smegmatis
Genetic Insert: MSMEG_0791
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174917 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0793
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174918 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0775
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174919 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0786
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174914 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0787
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174915 Copy
Species: Homo sapiens
Genetic Insert: Specificity Protein 1
Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:14873; Vector Backbone:pLentiCRISPRv2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33730584
Proper citation: RRID:Addgene_174907 Copy
Species: Mus musculus
Genetic Insert: Cre flanked by MmPeg10 UTRs
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34413232
Proper citation: RRID:Addgene_174862 Copy
Species: Homo sapiens
Genetic Insert: Cre flanked by HsPeg10 UTRs
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34413232
Proper citation: RRID:Addgene_174863 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0924
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174938 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0909
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174932 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0912
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174933 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0919
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174936 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0922
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174937 Copy
Species: Methanosarcina mazei
Genetic Insert: Mma PylRS
Vector Backbone Description: Backbone Marker:Addgene #140008 based on PB510B-1 (System Bioscience); Vector Backbone:pAS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34431592
Proper citation: RRID:Addgene_174890 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0876
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174927 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0880
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174928 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Met4 UIML
Vector Backbone Description: Vector Backbone:pet28(a); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:34763062
Proper citation: RRID:Addgene_174888 Copy
Species: M. smegmatis
Genetic Insert: MSMEG_0833
Vector Backbone Description: Vector Backbone:pMSR:Dendra; Vector Types:Bacterial Expression, Integrating Mycobacterial Expression Vector attL5. T7 expression in E. coli; Bacterial Resistance:Apramycin
Defining Citation: PMID:33653882
Comments: 5' cloning site: AseI (destroyed), 3' cloning site: HindIII (not destroyed)
Proper citation: RRID:Addgene_174922 Copy
Genetic Insert: Firefly Luciferase shRNA
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:7602; Vector Backbone:pQCXIP; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Comments: shRNA oligo sequence - 5'-CCTTACGCTGAGTACTTCGAGTGTGCTGTCCTCGAAGTACTCAGCGTAAGTTT
Proper citation: RRID:Addgene_17491 Copy
Genetic Insert: Tetracycline repressor
Vector Backbone Description: Backbone Size:8477; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_17492 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.