Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 461 showing 9201 ~ 9220 out of 69,655 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_213318

http://www.addgene.org/213318

Species: Homo sapiens
Genetic Insert: HTR1D
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: 5-hydroxytryptamine. Ensembl ID: ENSG00000179546, Uniprot ID: P28221

Proper citation: RRID:Addgene_213318 Copy   


  • RRID:Addgene_213319

http://www.addgene.org/213319

Species: Homo sapiens
Genetic Insert: HTR1E
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: 5-hydroxytryptamine. Ensembl ID: ENSG00000168830, Uniprot ID: P28566

Proper citation: RRID:Addgene_213319 Copy   


  • RRID:Addgene_213271

http://www.addgene.org/213271

Species: Homo sapiens
Genetic Insert: GPR174
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000147138, Uniprot ID: Q9BXC1

Proper citation: RRID:Addgene_213271 Copy   


  • RRID:Addgene_213273

http://www.addgene.org/213273

Species: Homo sapiens
Genetic Insert: GPR183
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000169508, Uniprot ID: P32249

Proper citation: RRID:Addgene_213273 Copy   


  • RRID:Addgene_213274

http://www.addgene.org/213274

Species: Homo sapiens
Genetic Insert: GPR19
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000183150, Uniprot ID: Q15760

Proper citation: RRID:Addgene_213274 Copy   


  • RRID:Addgene_213275

http://www.addgene.org/213275

Species: Homo sapiens
Genetic Insert: GPR20
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000204882, Uniprot ID: Q99678

Proper citation: RRID:Addgene_213275 Copy   


  • RRID:Addgene_213276

http://www.addgene.org/213276

Species: Homo sapiens
Genetic Insert: GPR21
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000188394, Uniprot ID: Q99679

Proper citation: RRID:Addgene_213276 Copy   


  • RRID:Addgene_213278

http://www.addgene.org/213278

Species: Homo sapiens
Genetic Insert: GPR27
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Orphan. Ensembl ID: ENSG00000170837, Uniprot ID: Q9NS67

Proper citation: RRID:Addgene_213278 Copy   


http://www.addgene.org/207607

Species: Homo sapiens
Genetic Insert: cgactcgcccggcagcgcac
Vector Backbone Description: Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37267110

Proper citation: RRID:Addgene_207607 Copy   


http://www.addgene.org/181707

Species: Homo sapiens
Genetic Insert: Kar2-Beta-Amyloid
Vector Backbone Description: Vector Backbone:pAG426-GAL-ccdb; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_181707 Copy   


  • RRID:Addgene_181709

http://www.addgene.org/181709

Species: Homo sapiens
Genetic Insert: TDP-43
Vector Backbone Description: Vector Backbone:pAG416-GAL-ccdb; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_181709 Copy   


  • RRID:Addgene_217378

    This resource has 1+ mentions.

http://www.addgene.org/217378

Species: Homo sapiens
Genetic Insert: B55
Vector Backbone Description: Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:38123684

Proper citation: RRID:Addgene_217378 Copy   


  • RRID:Addgene_207105

http://www.addgene.org/207105

Species: Homo sapiens
Genetic Insert: CGCTATCAAGATTTATACCT
Vector Backbone Description: Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37341699

Proper citation: RRID:Addgene_207105 Copy   


  • RRID:Addgene_217301

http://www.addgene.org/217301

Species: Homo sapiens
Genetic Insert: MAP2K1
Vector Backbone Description: Backbone Size:7565; Vector Backbone:pCW107-V5; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_217301 Copy   


  • RRID:Addgene_198342

http://www.addgene.org/198342

Species: Homo sapiens
Genetic Insert: Dynamin1
Vector Backbone Description: Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38663399

Proper citation: RRID:Addgene_198342 Copy   


  • RRID:Addgene_217832

    This resource has 1+ mentions.

http://www.addgene.org/217832

Species: Homo sapiens
Genetic Insert: 4A8 variant Fab
Vector Backbone Description: Backbone Marker:Whitehead Lab, Addgene #81169; Vector Backbone:pETconNK; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:38730230

Proper citation: RRID:Addgene_217832 Copy   


  • RRID:Addgene_213372

http://www.addgene.org/213372

Species: Homo sapiens
Genetic Insert: QRFP
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: QRFP. Ensembl ID: ENSG00000186867, Uniprot ID: Q96P65

Proper citation: RRID:Addgene_213372 Copy   


  • RRID:Addgene_217297

http://www.addgene.org/217297

Species: Homo sapiens
Genetic Insert: MAP2K1
Vector Backbone Description: Backbone Size:7565; Vector Backbone:pCW107-V5; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_217297 Copy   


  • RRID:Addgene_213373

http://www.addgene.org/213373

Species: Homo sapiens
Genetic Insert: RXFP1
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Relaxin family peptide. Ensembl ID: ENSG00000171509, Uniprot ID: Q9HBX9

Proper citation: RRID:Addgene_213373 Copy   


  • RRID:Addgene_213374

http://www.addgene.org/213374

Species: Homo sapiens
Genetic Insert: S1PR1
Vector Backbone Description: Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:37134173
Comments: Class: A, Family: Lysophospholipid. Ensembl ID: ENSG00000170989, Uniprot ID: P21453

Proper citation: RRID:Addgene_213374 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X