Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,655 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
HTR1D-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213318 HTR1D Homo sapiens Ampicillin PMID:37134173 Class: A, Family: 5-hydroxytryptamine. Ensembl ID: ENSG00000179546, Uniprot ID: P28221 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:21 0
HTR1E-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213319 HTR1E Homo sapiens Ampicillin PMID:37134173 Class: A, Family: 5-hydroxytryptamine. Ensembl ID: ENSG00000168830, Uniprot ID: P28566 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:21 0
GPR174-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213271 GPR174 Homo sapiens Ampicillin PMID:37134173 Class: A, Family: Orphan. Ensembl ID: ENSG00000147138, Uniprot ID: Q9BXC1 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:21 0
GPR183-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213273 GPR183 Homo sapiens Ampicillin PMID:37134173 Class: A, Family: Orphan. Ensembl ID: ENSG00000169508, Uniprot ID: P32249 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:21 0
GPR19-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213274 GPR19 Homo sapiens Ampicillin PMID:37134173 Class: A, Family: Orphan. Ensembl ID: ENSG00000183150, Uniprot ID: Q15760 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:21 0
GPR20-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213275 GPR20 Homo sapiens Ampicillin PMID:37134173 Class: A, Family: Orphan. Ensembl ID: ENSG00000204882, Uniprot ID: Q99678 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:24 0
GPR21-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213276 GPR21 Homo sapiens Ampicillin PMID:37134173 Class: A, Family: Orphan. Ensembl ID: ENSG00000188394, Uniprot ID: Q99679 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:21 0
GPR27-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213278 GPR27 Homo sapiens Ampicillin PMID:37134173 Class: A, Family: Orphan. Ensembl ID: ENSG00000170837, Uniprot ID: Q9NS67 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:24 0
3xMS2 TR knockin sgRNA 1
 
Resource Report
Resource Website 		RRID:Addgene_207607 cgactcgcccggcagcgcac Homo sapiens Ampicillin PMID:37267110 Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:23 0
pAG426-GAL-Kar2-Beta-Amyloid
 
Resource Report
Resource Website 		RRID:Addgene_181707 Kar2-Beta-Amyloid Homo sapiens Ampicillin Vector Backbone:pAG426-GAL-ccdb; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:22 0
pAG416-GAL-TDP-43
 
Resource Report
Resource Website 		RRID:Addgene_181709 TDP-43 Homo sapiens Ampicillin Vector Backbone:pAG416-GAL-ccdb; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:22 0
pcDNA3.4-GFP-TEV-B55
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_217378 B55 Homo sapiens Ampicillin PMID:38123684 Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:23 1
SHLD3 KO sgRNA #1
 
Resource Report
Resource Website 		RRID:Addgene_207105 CGCTATCAAGATTTATACCT Homo sapiens Ampicillin PMID:37341699 Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:26 0
MEK1-E102-I103del-V5
 
Resource Report
Resource Website 		RRID:Addgene_217301 MAP2K1 Homo sapiens Ampicillin Backbone Size:7565; Vector Backbone:pCW107-V5; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin E102-I103deletion 2026-08-29 01:20:27 0
Dyn1 R271E D291R
 
Resource Report
Resource Website 		RRID:Addgene_198342 Dynamin1 Homo sapiens Kanamycin PMID:38663399 Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin R271E D291R 2026-08-29 01:20:22 0
p4A8_S7T_BC
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_217832 4A8 variant Fab Homo sapiens Kanamycin PMID:38730230 Backbone Marker:Whitehead Lab, Addgene #81169; Vector Backbone:pETconNK; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin VL: S7T 2026-08-29 01:20:27 1
QRFP-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213372 QRFP Homo sapiens Ampicillin PMID:37134173 Class: A, Family: QRFP. Ensembl ID: ENSG00000186867, Uniprot ID: Q96P65 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:25 0
WT-MEK1-V5
 
Resource Report
Resource Website 		RRID:Addgene_217297 MAP2K1 Homo sapiens Ampicillin Backbone Size:7565; Vector Backbone:pCW107-V5; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 01:20:23 0
RXFP1-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213373 RXFP1 Homo sapiens Ampicillin PMID:37134173 Class: A, Family: Relaxin family peptide. Ensembl ID: ENSG00000171509, Uniprot ID: Q9HBX9 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:22 0
S1PR1-DuET
 
Resource Report
Resource Website 		RRID:Addgene_213374 S1PR1 Homo sapiens Ampicillin PMID:37134173 Class: A, Family: Lysophospholipid. Ensembl ID: ENSG00000170989, Uniprot ID: P21453 Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:20:22 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch