Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
HTR1D-DuET Resource Report Resource Website |
RRID:Addgene_213318 | HTR1D | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: 5-hydroxytryptamine. Ensembl ID: ENSG00000179546, Uniprot ID: P28221 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:21 | 0 | |
|
HTR1E-DuET Resource Report Resource Website |
RRID:Addgene_213319 | HTR1E | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: 5-hydroxytryptamine. Ensembl ID: ENSG00000168830, Uniprot ID: P28566 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:21 | 0 | |
|
GPR174-DuET Resource Report Resource Website |
RRID:Addgene_213271 | GPR174 | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: Orphan. Ensembl ID: ENSG00000147138, Uniprot ID: Q9BXC1 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:21 | 0 | |
|
GPR183-DuET Resource Report Resource Website |
RRID:Addgene_213273 | GPR183 | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: Orphan. Ensembl ID: ENSG00000169508, Uniprot ID: P32249 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:21 | 0 | |
|
GPR19-DuET Resource Report Resource Website |
RRID:Addgene_213274 | GPR19 | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: Orphan. Ensembl ID: ENSG00000183150, Uniprot ID: Q15760 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:21 | 0 | |
|
GPR20-DuET Resource Report Resource Website |
RRID:Addgene_213275 | GPR20 | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: Orphan. Ensembl ID: ENSG00000204882, Uniprot ID: Q99678 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:24 | 0 | |
|
GPR21-DuET Resource Report Resource Website |
RRID:Addgene_213276 | GPR21 | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: Orphan. Ensembl ID: ENSG00000188394, Uniprot ID: Q99679 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:21 | 0 | |
|
GPR27-DuET Resource Report Resource Website |
RRID:Addgene_213278 | GPR27 | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: Orphan. Ensembl ID: ENSG00000170837, Uniprot ID: Q9NS67 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:24 | 0 | |
|
3xMS2 TR knockin sgRNA 1 Resource Report Resource Website |
RRID:Addgene_207607 | cgactcgcccggcagcgcac | Homo sapiens | Ampicillin | PMID:37267110 | Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:23 | 0 | ||
|
pAG426-GAL-Kar2-Beta-Amyloid Resource Report Resource Website |
RRID:Addgene_181707 | Kar2-Beta-Amyloid | Homo sapiens | Ampicillin | Vector Backbone:pAG426-GAL-ccdb; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:22 | 0 | |||
|
pAG416-GAL-TDP-43 Resource Report Resource Website |
RRID:Addgene_181709 | TDP-43 | Homo sapiens | Ampicillin | Vector Backbone:pAG416-GAL-ccdb; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:22 | 0 | |||
|
pcDNA3.4-GFP-TEV-B55 Resource Report Resource Website 1+ mentions |
RRID:Addgene_217378 | B55 | Homo sapiens | Ampicillin | PMID:38123684 | Vector Backbone:pcDNA3.4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:23 | 1 | ||
|
SHLD3 KO sgRNA #1 Resource Report Resource Website |
RRID:Addgene_207105 | CGCTATCAAGATTTATACCT | Homo sapiens | Ampicillin | PMID:37341699 | Backbone Size:8484; Vector Backbone:pX330 Addgene #42230; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:26 | 0 | ||
|
MEK1-E102-I103del-V5 Resource Report Resource Website |
RRID:Addgene_217301 | MAP2K1 | Homo sapiens | Ampicillin | Backbone Size:7565; Vector Backbone:pCW107-V5; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | E102-I103deletion | 2026-08-29 01:20:27 | 0 | ||
|
Dyn1 R271E D291R Resource Report Resource Website |
RRID:Addgene_198342 | Dynamin1 | Homo sapiens | Kanamycin | PMID:38663399 | Backbone Marker:Clontech; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | R271E D291R | 2026-08-29 01:20:22 | 0 | |
|
p4A8_S7T_BC Resource Report Resource Website 1+ mentions |
RRID:Addgene_217832 | 4A8 variant Fab | Homo sapiens | Kanamycin | PMID:38730230 | Backbone Marker:Whitehead Lab, Addgene #81169; Vector Backbone:pETconNK; Vector Types:Yeast Expression; Bacterial Resistance:Kanamycin | VL: S7T | 2026-08-29 01:20:27 | 1 | |
|
QRFP-DuET Resource Report Resource Website |
RRID:Addgene_213372 | QRFP | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: QRFP. Ensembl ID: ENSG00000186867, Uniprot ID: Q96P65 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:25 | 0 | |
|
WT-MEK1-V5 Resource Report Resource Website |
RRID:Addgene_217297 | MAP2K1 | Homo sapiens | Ampicillin | Backbone Size:7565; Vector Backbone:pCW107-V5; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:23 | 0 | |||
|
RXFP1-DuET Resource Report Resource Website |
RRID:Addgene_213373 | RXFP1 | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: Relaxin family peptide. Ensembl ID: ENSG00000171509, Uniprot ID: Q9HBX9 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:22 | 0 | |
|
S1PR1-DuET Resource Report Resource Website |
RRID:Addgene_213374 | S1PR1 | Homo sapiens | Ampicillin | PMID:37134173 | Class: A, Family: Lysophospholipid. Ensembl ID: ENSG00000170989, Uniprot ID: P21453 | Vector Backbone:pcDNA 3.1 (+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:20:22 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.