Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:homo sapiens (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

69,655 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pAAV-hSyn-GRAB_ACh3.0
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_121922 GPCR activation based ACh sensor GRAB-ACh3.0 Homo sapiens Ampicillin PMID:32989318 Backbone Size:4495; Vector Backbone:pAAV vector; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 12:53:27 13
pAAV-hSyn-DIO-GRAB_ACh3.0
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_121923 GPCR activation based ACh sensor GRAB-ACh3.0 Homo sapiens Ampicillin PMID:32989318 Backbone Size:4495; Vector Backbone:pAAV vector; Vector Types:AAV; Bacterial Resistance:Ampicillin 2026-08-29 12:53:30 4
pLX401-INK4A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_121919 p16-INK4A Homo sapiens Ampicillin PMID:30755442 p16-INK4A was codon-optimized for synthesis as a gBlock from Integrated DNA Technologies and Gateway cloned into pLX401 (pCW57.1, Addgene #41393). Backbone Marker:David Root; Backbone Size:9354; Vector Backbone:pLX401 (pCW57.1, Addgene #41393); Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 12:53:27 5
pcDNA3-Flag Rac2
 
Resource Report
Resource Website 		RRID:Addgene_12192 Rac2 Homo sapiens Ampicillin PMID:14676277 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 12:53:30 0
pJ3M-Mst1 K59R
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12204 Mst1 Homo sapiens Ampicillin PMID:8702870 Backbone Size:3500; Vector Backbone:pJ3M; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Catalytically inactive: K59R 2026-08-29 12:53:28 2
pJ3H-Mst1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12203 Mst1 Homo sapiens Ampicillin PMID:8702870 Backbone Size:3500; Vector Backbone:pJ3H; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 12:53:31 5
pJ3H-Mst2 K56R
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12206 Mst2 Homo sapiens Ampicillin PMID:8702870 Addgene's QC finds additional E303D and T342M substitutions which are not known to affect function Backbone Size:3500; Vector Backbone:pJ3H; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Catalytically inactive: K56R 2026-08-29 12:53:29 2
pSlick-Neo-RECK
 
Resource Report
Resource Website 		RRID:Addgene_121986 RECK Homo sapiens Ampicillin PMID:29805750 Vector Backbone:pSlick-Neo; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-29 12:53:28 0
DN1-Gli3 in AINGpCAGGS
 
Resource Report
Resource Website 		RRID:Addgene_121970 DN2Gli3 Homo sapiens Ampicillin PMID:15741323 The GLI3 insert contains an S1131G difference compared to NM_000168.6 that does not affect function. Backbone Marker:home made using pCAGGS; Backbone Size:6200; Vector Backbone:Linker A IRES NLS GFP pCAGGS; Vector Types:Mammalian Expression, chick electroporation; Bacterial Resistance:Ampicillin N terminus deletion (nt1-864) 2026-08-29 12:53:31 0
Gli3ZF in AINGpCAGGS
 
Resource Report
Resource Website 		RRID:Addgene_121972 Gli3ZF Homo sapiens Ampicillin The GLI3 insert contains an S1131G difference compared to NM_000168.6 that does not affect function. Backbone Marker:home made using pCAGGS; Backbone Size:6200; Vector Backbone:Linker A IRES NLS GFP pCAGGS; Vector Types:Mammalian Expression, chick electroporation; Bacterial Resistance:Ampicillin N terminus and C terminus deletion only nt 1411-1935 included 2026-08-29 12:53:28 0
pHR-BRD4ΔN-mCherry-sspB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_121968 BRD4 Homo sapiens Ampicillin PMID:30500535 Vector contains SspB, a bacterial protein which binds exposed SsrA tag (from iLID) at high affinity. Backbone Size:9000; Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Deleted amino acids 1-461 2026-08-29 12:53:31 1
DN2-Gli3 in AINGpCAGGS
 
Resource Report
Resource Website 		RRID:Addgene_121969 DN2Gli3 Homo sapiens Ampicillin PMID:15741323 The GLI3 insert contains an S1131G difference compared to NM_000168.6 that does not affect function. Backbone Marker:home made using pCAGGS; Backbone Size:6200; Vector Backbone:Linker A IRES NLS GFP pCAGGS; Vector Types:Mammalian Expression, chick electroporation; Bacterial Resistance:Ampicillin N terminus deletion (nt1-1401) 2026-08-29 12:53:28 0
CYFIP1.mCherry
 
Resource Report
Resource Website 		RRID:Addgene_122051 CYFIP1 Homo sapiens Kanamycin PMID:24667445 Backbone Marker:Clontech; Vector Backbone:pmcherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 12:53:28 0
LL - hOCT4i -1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12198 OCT4 - RNAi Homo sapiens Ampicillin PMID:15749924 Target sequence: CATGTGTAAGCTGCGGCCCTT (NM_002701: bp 642-662) Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 12:53:28 1
LL - hOCT4i -2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12197 OCT4 - RNAi Homo sapiens Ampicillin PMID:15749924 Target sequence: GGATGTGGTCCGAGTGTGGTT (NM_002701: bp 867-887) Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin 2026-08-29 12:53:28 1
pcDNA3-Flag-RNF125
 
Resource Report
Resource Website 		RRID:Addgene_122045 RNF125 Homo sapiens Ampicillin Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 12:53:28 0
pCMV6M-PAK1 T423E
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_12208 Pak1 Homo sapiens Ampicillin PMID:9395435 There is also an additional mutation in this plasmid - L516I. The L516I mutation, or SNP, has been present from the very beginning (~1995). The crystal structure of Pak1 uses this clone, so it is present there too. The depositor does not think it affects function in any way. Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function. Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Activated Pak1: T423E 2026-08-29 12:53:29 18
pCMV6M-Pak1 P13A
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12207 Pak1 Homo sapiens Ampicillin PMID:8798379 Pak1 may contain a G401S mutation. Depositor states that this mutation should not affect plasmid function. Backbone Size:4900; Vector Backbone:pCMV6; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin P13A: disrupts first polyproline region of Pak1 2026-08-29 12:53:32 1
pEBG-Pak1 83-149
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_12214 Pak1 Homo sapiens Ampicillin PMID:11719502 Backbone Size:6100; Vector Backbone:pEBG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Dominant negative Pak1: autoinhibitory domain, aa 83-149 2026-08-29 12:53:33 3
pGEXTK-Pak1 70-117
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_12217 Pak1 Homo sapiens Ampicillin Backbone Marker:Amersham; Backbone Size:5000; Vector Backbone:pGEX2TK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin PBD (p21-binding domain), aa 70-117 2026-08-29 12:53:30 24

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch