Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23995389
Comments: For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/
Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3
Proper citation: RRID:Addgene_47549 Copy
Species: Homo sapiens
Genetic Insert: MEK5-DD
Vector Backbone Description: Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:23332156
Proper citation: RRID:Addgene_47547 Copy
Species: Synthetic
Genetic Insert: SOX2 shRNA
Vector Backbone Description: Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22941189
Proper citation: RRID:Addgene_47540 Copy
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23145123
Proper citation: RRID:Addgene_47539 Copy
Species: Homo sapiens
Genetic Insert: cyclin E1
Vector Backbone Description: Backbone Size:6521; Vector Backbone:MIGR1; Vector Types:Mammalian Expression, Retroviral, MSCV-IRES-GFP; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23873023
Comments: Human cyclin E1 (CCNE1) cDNA was mutated at N- and C-terminal Cdc4 phosphodegrons (T62A and T380A, see references) to disrupt interaction with Fbw7 ubiquitin ligase. cDNA is inserted into MIGR1 (MSCV-based retroviral vector), permitting transduction of hematopoietic cells.
Cloned cDNA contains approximately 100 bp from CCNE1 3' UTR.
GFP is co-expressed with cDNA via IRES, permitting enrichment for transduced cells using flow sorting.
References:
Koepp DM, Schaefer LK, Ye X, Keyomarsi K, Chu C, Harper JW et al (2001). Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7 ubiquitin ligase. Science 294: 173-177.
Strohmaier H, Spruck CH, Kaiser P, Won KA, Sangfelt O, Reed SI (2001). Human F-box protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line. Nature 413: 316-322.
Proper citation: RRID:Addgene_47498 Copy
Species: Homo sapiens
Genetic Insert: CALML3
Vector Backbone Description: Backbone Marker:Pharmacia; Backbone Size:4580; Vector Backbone:pKK233-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:1334432
Proper citation: RRID:Addgene_47599 Copy
Species: Synthetic
Genetic Insert: gRNA-EGFP site 2
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23792628
Comments: Target site: GATGCCGTTCTTCTGCTTGT
gRNA expression vector targeting EGFP for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)
Proper citation: RRID:Addgene_47512 Copy
Species: Mus musculus
Genetic Insert: PMCA4b
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_47597 Copy
Species: Other
Genetic Insert: GFP
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23876708
Proper citation: RRID:Addgene_47516 Copy
Species: Homo sapiens
Genetic Insert: PMCA4b-D672E
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_47596 Copy
Species: Homo sapiens
Genetic Insert: PMCA4bct120
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: x/b splice variant of human PMCA4
Proper citation: RRID:Addgene_47593 Copy
Species: Homo sapiens
Genetic Insert: PMCA4bct125
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: x/b splice variant of human PMCA4
Proper citation: RRID:Addgene_47594 Copy
Species: Homo sapiens
Genetic Insert: gRNA-VEGF site 3
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23792628
Comments: Target site: GGTGAGTGAGTGTGTGCGTG
gRNA expression vector targeting human VEGF for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9)
Proper citation: RRID:Addgene_47507 Copy
Species: Homo sapiens
Genetic Insert: PMCA2w/b delta6
Vector Backbone Description: Backbone Marker:Clontech; modified as described in Rogers et al JBC 2005; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12624087
Proper citation: RRID:Addgene_47588 Copy
Species: Homo sapiens
Genetic Insert: PMCA4x/b
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12624087
Comments: HPMCA4x/b coding sequence starts with amino acid 2 (Thr) at pos 1354.
This plasmid carries two missense mutations that cause K442R and P663L in the amino acid sequence of hPMCA4b. The depositing lab did not notice any functional consequences in the assays they performed. However, these were mostly concerned with membrane localization and did not include any enzymatic functional studies. Thus, it is not know whether (and how) these two mutations affect the calcium-pumping enzymatic function of the encoded GFP-hPMCA4b protein.
Proper citation: RRID:Addgene_47589 Copy
Species: Homo sapiens
Genetic Insert: PMCA2w/b
Vector Backbone Description: Backbone Marker:Clontech; modified as described in Rogers et al JBC 2003; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12624087
Comments: w/b splice variant of human PMCA2. PMCA2w/b inserted as SacII-XbaI fragment into multiple cloning site but is also flanked by NotI sites. PMCA2 start: 1396; stop: 5125, w-splice: 2303
Proper citation: RRID:Addgene_47586 Copy
Species: Homo sapiens
Genetic Insert: Glucocorticoid receptor
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_47504 Copy
Species: Homo sapiens
Genetic Insert: PMCA2z/b
Vector Backbone Description: Backbone Marker:Penniston Lab; Backbone Size:5145; Vector Backbone:pMM2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12624087
Comments: z/b splice variant of human PMCA2. PMCA2 start: 1104; stop: 4700, z-splice: 2010/11; b-splice: 4389-4700
Proper citation: RRID:Addgene_47581 Copy
Species: Homo sapiens
Genetic Insert: pMCA2z/b
Vector Backbone Description: Backbone Marker:Clontech; modified as described in Rogers et al JBC 2001; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12624087
Comments: z/b splice variant of human PMCA2
Proper citation: RRID:Addgene_47584 Copy
Species: Homo sapiens
Genetic Insert: PMCA2x/b
Vector Backbone Description: Backbone Marker:Penniston Lab; Backbone Size:5145; Vector Backbone:pMM2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12624087
Comments: x/b splice variant of human PMCA2. PMCA2 start: 1090; stop: 4728, x-splice: 1997-2038; b-splice: starts at 4417.
Proper citation: RRID:Addgene_47582 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
