Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDD162 (Peft-3::Cas9 + Empty sgRNA) Resource Report Resource Website 100+ mentions |
RRID:Addgene_47549 | Cas9 | Synthetic | Ampicillin | PMID:23995389 | For more information on Goldstein Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Goldstein/ Please note: eft-3 has officially been changed to eef-1A.1 Please see the eef-1A.1 WormBase entry for details: http://www.wormbase.org/species/c_elegans/gene/WBGene00001168#05-9g-3 | Backbone Size:2300; Vector Backbone:pCFJ601; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | Codon optimized and with synthetic introns for C. elegans | 2026-09-01 09:55:44 | 164 |
|
pEN_TT MEK5-DD-mRFP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47547 | MEK5-DD | Homo sapiens | Gentamicin | PMID:23332156 | Backbone Marker:Addgene #25752; Backbone Size:4422; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | S311D, T315D | 2026-09-01 09:55:44 | 1 | |
|
Tet-pLKO-puro-SOX2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47540 | SOX2 shRNA | Synthetic | Ampicillin | PMID:22941189 | Backbone Size:10633; Vector Backbone:Tet-pLKO-puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:44 | 2 | ||
|
pMSCVpuroATT Resource Report Resource Website 1+ mentions |
RRID:Addgene_47539 | Chloramphenicol and Ampicillin | PMID:23145123 | Backbone Marker:Clontech; Backbone Size:6300; Vector Backbone:pMSCVpuro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-09-01 09:55:44 | 1 | ||||
|
MIGR1-cyclin E-AA Resource Report Resource Website 1+ mentions |
RRID:Addgene_47498 | cyclin E1 | Homo sapiens | Ampicillin | PMID:23873023 | Human cyclin E1 (CCNE1) cDNA was mutated at N- and C-terminal Cdc4 phosphodegrons (T62A and T380A, see references) to disrupt interaction with Fbw7 ubiquitin ligase. cDNA is inserted into MIGR1 (MSCV-based retroviral vector), permitting transduction of hematopoietic cells. Cloned cDNA contains approximately 100 bp from CCNE1 3' UTR. GFP is co-expressed with cDNA via IRES, permitting enrichment for transduced cells using flow sorting. References: Koepp DM, Schaefer LK, Ye X, Keyomarsi K, Chu C, Harper JW et al (2001). Phosphorylation-dependent ubiquitination of cyclin E by the SCFFbw7 ubiquitin ligase. Science 294: 173-177. Strohmaier H, Spruck CH, Kaiser P, Won KA, Sangfelt O, Reed SI (2001). Human F-box protein hCdc4 targets cyclin E for proteolysis and is mutated in a breast cancer cell line. Nature 413: 316-322. | Backbone Size:6521; Vector Backbone:MIGR1; Vector Types:Mammalian Expression, Retroviral, MSCV-IRES-GFP; Bacterial Resistance:Ampicillin | threonines 62 and 380 to alanine (T62A T380A) | 2026-09-01 09:55:44 | 1 |
|
pKK233-hCALML3 Resource Report Resource Website |
RRID:Addgene_47599 | CALML3 | Homo sapiens | Ampicillin | PMID:1334432 | Backbone Marker:Pharmacia; Backbone Size:4580; Vector Backbone:pKK233-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | contains 538 bp fragment | 2026-09-01 09:55:45 | 0 | |
|
pFYF1327 EGFP Site#2 Resource Report Resource Website |
RRID:Addgene_47512 | gRNA-EGFP site 2 | Synthetic | Ampicillin | PMID:23792628 | Target site: GATGCCGTTCTTCTGCTTGT gRNA expression vector targeting EGFP for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9) | Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:44 | 0 | |
|
pcDNA3.1-mPMCA4b Resource Report Resource Website |
RRID:Addgene_47597 | PMCA4b | Mus musculus | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:45 | 0 | |||
|
pAraGFPCDF Resource Report Resource Website |
RRID:Addgene_47516 | GFP | Other | Spectinomycin | PMID:23876708 | Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | 2026-09-01 09:55:44 | 0 | ||
|
pcDNA3.1-hPMCA4b-D672E Resource Report Resource Website |
RRID:Addgene_47596 | PMCA4b-D672E | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D672E (reducing the ATPase activity to less than 10%) | 2026-09-01 09:55:45 | 0 | ||
|
EGFP-hPMCA4bct120 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47593 | PMCA4bct120 | Homo sapiens | Kanamycin | x/b splice variant of human PMCA4 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 120 C terminal AA deleted (constitutively active form) | 2026-09-01 09:55:45 | 1 | |
|
EGFP-hPMCA4bct125 Resource Report Resource Website |
RRID:Addgene_47594 | PMCA4bct125 | Homo sapiens | Kanamycin | x/b splice variant of human PMCA4 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 125 C terminal AA deleted | 2026-09-01 09:55:45 | 0 | |
|
pVC228 VEGF Site#3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_47507 | gRNA-VEGF site 3 | Homo sapiens | Ampicillin | PMID:23792628 | Target site: GGTGAGTGAGTGTGTGCGTG gRNA expression vector targeting human VEGF for use with JDS246 (Addgene plasmid# 43861--mammalian codon-optimized streptococcus pyogenes Cas9) | Backbone Marker:Joung lab (Addgene plasmid #43860); Backbone Size:2278; Vector Backbone:MLM3636; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:44 | 3 | |
|
EGFP-hPCM2w/b delta6 Resource Report Resource Website |
RRID:Addgene_47588 | PMCA2w/b delta6 | Homo sapiens | Kanamycin | PMID:12624087 | Backbone Marker:Clontech; modified as described in Rogers et al JBC 2005; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 6 C-terminal AA deleted (needed for PDZ binding) | 2026-09-01 09:55:45 | 0 | |
|
EGFP-hPMCA4b Resource Report Resource Website 1+ mentions |
RRID:Addgene_47589 | PMCA4x/b | Homo sapiens | Kanamycin | PMID:12624087 | HPMCA4x/b coding sequence starts with amino acid 2 (Thr) at pos 1354. This plasmid carries two missense mutations that cause K442R and P663L in the amino acid sequence of hPMCA4b. The depositing lab did not notice any functional consequences in the assays they performed. However, these were mostly concerned with membrane localization and did not include any enzymatic functional studies. Thus, it is not know whether (and how) these two mutations affect the calcium-pumping enzymatic function of the encoded GFP-hPMCA4b protein. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C2; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | K442R and P673L relative to NP_001675.3 | 2026-09-01 09:55:45 | 1 |
|
EGFP-hPMCA2w/b Resource Report Resource Website 1+ mentions |
RRID:Addgene_47586 | PMCA2w/b | Homo sapiens | Kanamycin | PMID:12624087 | w/b splice variant of human PMCA2. PMCA2w/b inserted as SacII-XbaI fragment into multiple cloning site but is also flanked by NotI sites. PMCA2 start: 1396; stop: 5125, w-splice: 2303 | Backbone Marker:Clontech; modified as described in Rogers et al JBC 2003; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:55:45 | 2 | |
|
pEGFP GR Resource Report Resource Website 10+ mentions |
RRID:Addgene_47504 | Glucocorticoid receptor | Homo sapiens | Kanamycin | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:55:44 | 13 | |||
|
pMM2-hPMCA2z/b Resource Report Resource Website 1+ mentions |
RRID:Addgene_47581 | PMCA2z/b | Homo sapiens | Ampicillin | PMID:12624087 | z/b splice variant of human PMCA2. PMCA2 start: 1104; stop: 4700, z-splice: 2010/11; b-splice: 4389-4700 | Backbone Marker:Penniston Lab; Backbone Size:5145; Vector Backbone:pMM2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:44 | 1 | |
|
EGFP-hPMCA2z/b Resource Report Resource Website 1+ mentions |
RRID:Addgene_47584 | pMCA2z/b | Homo sapiens | Kanamycin | PMID:12624087 | z/b splice variant of human PMCA2 | Backbone Marker:Clontech; modified as described in Rogers et al JBC 2001; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:55:45 | 2 | |
|
pMM2-hPMCA2x/b Resource Report Resource Website |
RRID:Addgene_47582 | PMCA2x/b | Homo sapiens | Ampicillin | PMID:12624087 | x/b splice variant of human PMCA2. PMCA2 start: 1090; stop: 4728, x-splice: 1997-2038; b-splice: starts at 4417. | Backbone Marker:Penniston Lab; Backbone Size:5145; Vector Backbone:pMM2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:44 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
