Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
On page 469 showing 9361 ~ 9380 out of 32,424 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

    • RRID:Addgene_8982

    This resource has 10+ mentions.

http://www.addgene.org/8982

Species: Homo sapiens
Genetic Insert: Filamin A
Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15024089
Comments: Addgene sequencing results find amino acid substitution D2626H compared to reference sequence NP_001447.1.

Proper citation: RRID:Addgene_8982 Copy   

    • RRID:Addgene_8986

    This resource has 1+ mentions.

http://www.addgene.org/8986

Species: Rattus norvegicus
Genetic Insert: S6K1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11967149
Comments: F5A is a mutation in the TOR signalling (TOS) motif.

Proper citation: RRID:Addgene_8986 Copy   

    • RRID:Addgene_8985

    This resource has 1+ mentions.

http://www.addgene.org/8985

Species: Rattus norvegicus
Genetic Insert: S6K1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11967149

Proper citation: RRID:Addgene_8985 Copy   

    • RRID:Addgene_8984

    This resource has 10+ mentions.

http://www.addgene.org/8984

Species: Rattus norvegicus
Genetic Insert: S6K1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11967149

Proper citation: RRID:Addgene_8984 Copy   

    • RRID:Addgene_8983

    This resource has 10+ mentions.

http://www.addgene.org/8983

Species: Homo sapiens
Genetic Insert: Filamin A S2152A
Vector Backbone Description: Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15024089
Comments: S2152A mutation made using Stratgene Quikchange mutagenesis kit. 5' FLNa-Ala2152 primer (GCAGGCGTCGGGCTCCTGCAGTGGCCAACGTTG) and 3' FLNa-Ala2152 primer (CAACGTTGGCCACTGCAGGAGCCCGACGCCTGC). See author's map for details of wild-type version of this plasmid.

Proper citation: RRID:Addgene_8983 Copy   

    • RRID:Addgene_8979

    This resource has 1+ mentions.

http://www.addgene.org/8979

Species: Rattus norvegicus
Genetic Insert: ERK2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16051177
Comments: D-domain docking mutant.

Proper citation: RRID:Addgene_8979 Copy   

http://www.addgene.org/89793

Species: Synthetic
Genetic Insert: site-specific DNA-methyltransferase SssI
Vector Backbone Description: Backbone Size:14759; Vector Backbone:pLV hUbC-dCas9-T2A-GFP (#53191); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28695892

Proper citation: RRID:Addgene_89793 Copy   

    • RRID:Addgene_8974

    This resource has 10+ mentions.

http://www.addgene.org/8974

Species: Rattus norvegicus
Genetic Insert: ERK2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16051177

Proper citation: RRID:Addgene_8974 Copy   

    • RRID:Addgene_89906

    This resource has 1+ mentions.

http://www.addgene.org/89906

Species: P. buccae ATCC 33574
Genetic Insert: Cas13b
Vector Backbone Description: Backbone Size:4245; Vector Backbone:pACYC184; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:28065598
Comments: Benchling sequence link: https://benchling.com/s/hqikFD6s

Proper citation: RRID:Addgene_89906 Copy   

    • RRID:Addgene_89986

    This resource has 1+ mentions.

http://www.addgene.org/89986

Species: Synthetic
Genetic Insert: LSSmCherry1
Vector Backbone Description: Vector Backbone:pBAD His B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28241009

Proper citation: RRID:Addgene_89986 Copy   

    • RRID:Addgene_89985

    This resource has 1+ mentions.

http://www.addgene.org/89985

Species: Other
Genetic Insert: dCas9-VPR
Vector Backbone Description: Vector Backbone:AAVS1 homologous recombineering donor plasmid; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28116670

Proper citation: RRID:Addgene_89985 Copy   

    • RRID:Addgene_8993

    This resource has 1+ mentions.

http://www.addgene.org/8993

Species: Rattus norvegicus
Genetic Insert: S6K1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11967149

Proper citation: RRID:Addgene_8993 Copy   

    • RRID:Addgene_89975

    This resource has 1+ mentions.

http://www.addgene.org/89975

Species: Homo sapiens
Genetic Insert: ataxin-3
Vector Backbone Description: Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:28275011

Proper citation: RRID:Addgene_89975 Copy   

    • RRID:Addgene_8995

    This resource has 1+ mentions.

http://www.addgene.org/8995

Species: Homo sapiens
Genetic Insert: TSC1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pRK7; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12271141
Comments: Addgene sequencing results find amino acid substitutions R768H and I812M compared to hamartin reference sequence NP_000359.1.

Proper citation: RRID:Addgene_8995 Copy   

http://www.addgene.org/9000

Species: Rattus norvegicus
Genetic Insert: 14-3-3 gamma
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Created by Francisca Vazquez.

Proper citation: RRID:Addgene_9000 Copy   

    • RRID:Addgene_89928

    This resource has 1+ mentions.

http://www.addgene.org/89928

Species: Homo sapiens
Genetic Insert: human insulin-Gaussia-Luciferase
Vector Backbone Description: Backbone Marker:Invitrogen (CMV removed); Backbone Size:5091; Vector Backbone:pcDNA3.1+rInsp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27819058

Proper citation: RRID:Addgene_89928 Copy   

http://www.addgene.org/89991

Species: Homo sapiens
Genetic Insert: SOX2-T2A-2xNLS-TdTomato-F2A-Puro
Vector Backbone Description: Backbone Size:2657; Vector Backbone:pUC19; Vector Types:CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28952927

Proper citation: RRID:Addgene_89991 Copy   

    • RRID:Addgene_89941

    This resource has 1+ mentions.

http://www.addgene.org/89941

Species: Homo sapiens
Genetic Insert: human syntaxin17 lacking N-terminal domain
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6875; Vector Backbone:pMRXIP GFP-Ci2; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28598244

Proper citation: RRID:Addgene_89941 Copy   

    • RRID:Addgene_90007

    This resource has 1+ mentions.

http://www.addgene.org/90007

Species: Homo sapiens
Genetic Insert: BRD4
Vector Backbone Description: Backbone Size:5137; Vector Backbone:pcDNA5 frt/to; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26735014

Proper citation: RRID:Addgene_90007 Copy   

    • RRID:Addgene_89937

    This resource has 1+ mentions.

http://www.addgene.org/89937

Species: Rattus norvegicus
Genetic Insert: rat Lamp1
Vector Backbone Description: Backbone Marker:Dr.Shoji Yamaoka of Tokyo Medical and Dental University; Backbone Size:6832; Vector Backbone:pMRXIP Venus-N; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27885029

Proper citation: RRID:Addgene_89937 Copy   

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch