Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 469 showing 9361 ~ 9380 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_61080

http://www.addgene.org/61080

Species: Homo sapiens
Genetic Insert: gRNA_hIRF1 promoter #12
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25051498
Comments: gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG

Proper citation: RRID:Addgene_61080 Copy   


  • RRID:Addgene_61086

http://www.addgene.org/61086

Species: Mus musculus
Genetic Insert: smallest constitutive BIN1excluding exon 7, 11, 13-17
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577

Proper citation: RRID:Addgene_61086 Copy   


  • RRID:Addgene_61002

http://www.addgene.org/61002

Species: Other
Genetic Insert: Chloramphenicol acetyltransferase
Vector Backbone Description: Backbone Marker:Ambion; Vector Backbone:pAMB; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26781350

Proper citation: RRID:Addgene_61002 Copy   


  • RRID:Addgene_61089

    This resource has 1+ mentions.

http://www.addgene.org/61089

Species: Homo sapiens
Genetic Insert: H1 promoter; gRNA sequences
Vector Backbone Description: Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25209046
Comments: As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site.

Proper citation: RRID:Addgene_61089 Copy   


  • RRID:Addgene_61000

    This resource has 1+ mentions.

http://www.addgene.org/61000

Species: Thermoanaerobacter tengcongensis MB4
Genetic Insert: TTE1564 transcript
Vector Backbone Description: Backbone Size:2700; Vector Backbone:pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26781350

Proper citation: RRID:Addgene_61000 Copy   


  • RRID:Addgene_61088

http://www.addgene.org/61088

Species: Homo sapiens
Genetic Insert: SENP2M497A catalytic domain
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23955022

Proper citation: RRID:Addgene_61088 Copy   


  • RRID:Addgene_61017

    This resource has 1+ mentions.

http://www.addgene.org/61017

Species: Synthetic
Genetic Insert: ddGFP B
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108

Proper citation: RRID:Addgene_61017 Copy   


  • RRID:Addgene_61018

http://www.addgene.org/61018

Species: Synthetic
Genetic Insert: ddGFP A
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25622108

Proper citation: RRID:Addgene_61018 Copy   


  • RRID:Addgene_61093

http://www.addgene.org/61093

Species: Mus musculus
Genetic Insert: Mag genomic sequence
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23704325

Proper citation: RRID:Addgene_61093 Copy   


  • RRID:Addgene_61092

http://www.addgene.org/61092

Species: Cricetulus griseus
Genetic Insert: pkac2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:12574406
Comments: The Y307H found in Addgene's QC sequence has no known functional consequence.

Proper citation: RRID:Addgene_61092 Copy   


  • RRID:Addgene_61090

http://www.addgene.org/61090

Species: Mus musculus
Genetic Insert: hnRNP A1
Vector Backbone Description: Backbone Size:6700; Vector Backbone:pHMTC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23704325

Proper citation: RRID:Addgene_61090 Copy   


  • RRID:Addgene_61096

http://www.addgene.org/61096

Species: Mus musculus
Genetic Insert: mouse BIN1 with exon 17, excluding exon 7, 11, 13-16
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836577

Proper citation: RRID:Addgene_61096 Copy   


  • RRID:Addgene_61026

    This resource has 1+ mentions.

http://www.addgene.org/61026

Species: Equus*
Genetic Insert: horse cytochrome c
Vector Backbone Description: Backbone Marker:Multiple labs; Vector Backbone:pBTR(C102T); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11437597
Comments: Notes from depositor: CYC3 encodes the enzyme, which we call heme lysase in the paper, that covalently attaches the heme to the apocytochrome c. That is, the plasmid has BOTH the CYC3 gene and the structural gene for horse cytochrome c. The horse cytochrome C sequence has been codon optimized.

Proper citation: RRID:Addgene_61026 Copy   


  • RRID:Addgene_61021

    This resource has 1+ mentions.

http://www.addgene.org/61021

Vector Backbone Description: Backbone Marker:Andrew Fire (Addgene plasmid #1490); Backbone Size:4526; Vector Backbone:pPD95_67; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Comments: This vector can be used to create N- terminal or C-terminal mCherry tagged fusion proteins for expression in C. elegans. The mCherry and a modified MCS was inserted into the vector backbone using AgeI and EcoRI sites. See plasmid map and sequence for more information. Note that mCherry has been codon optimized for C. elegans expression. See pCFJ90 (Plasmid #19327) for details on the mCherry protein sequence.

Proper citation: RRID:Addgene_61021 Copy   


  • RRID:Addgene_61151

http://www.addgene.org/61151

Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
Defining Citation: PMID:23479654
Comments: In addition to the wt copy of lacI, another copy of lacI driven by PIq is integrated at the attB Contains another copy of araC driven by a constitutive promoter in addition to wt araC.

Proper citation: RRID:Addgene_61151 Copy   


  • RRID:Addgene_61156

http://www.addgene.org/61156

Species: Escherichia coli
Genetic Insert: gusA
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:10404164
Comments: Matsumura lab strain number 337

Proper citation: RRID:Addgene_61156 Copy   


  • RRID:Addgene_61034

http://www.addgene.org/61034

Species: Danio rerio
Genetic Insert: HSPB7
Vector Backbone Description: Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18161059
Comments: linearize with NotI, transcribe with SP6, probe length is 519. Note: Addgene's quality control sequencing has found a few mismatches in the plasmid insert, but they should not affect its ability to be used as a probe.

Proper citation: RRID:Addgene_61034 Copy   


  • RRID:Addgene_61154

http://www.addgene.org/61154

Species: Saccharomyces cerevisiae
Genetic Insert: TFIIH complex serine/threonine-protein kinase subunit KIN28
Vector Backbone Description: Backbone Marker:Herren, B., and Pech, M. (1993) J. Recept. Res. 13, 725–738; Vector Backbone:pRS425Gal1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11805111

Proper citation: RRID:Addgene_61154 Copy   


  • RRID:Addgene_60995

http://www.addgene.org/60995

Species: Synthetic
Genetic Insert: citrine
Vector Backbone Description: Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26010570
Comments: Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.

Proper citation: RRID:Addgene_60995 Copy   


  • RRID:Addgene_60994

http://www.addgene.org/60994

Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26010570
Comments: Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region.

Proper citation: RRID:Addgene_60994 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X