Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
gRNA-hIRF-1 #12/pSIR
 
Resource Report
Resource Website
RRID:Addgene_61080 gRNA_hIRF1 promoter #12 Homo sapiens Ampicillin PMID:25051498 gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin 2026-08-29 01:08:13 0
pDest27-mBIN1
 
Resource Report
Resource Website
RRID:Addgene_61086 smallest constitutive BIN1excluding exon 7, 11, 13-17 Mus musculus Ampicillin PMID:24836577 Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:13 0
pAMB_CAT-FspI
 
Resource Report
Resource Website
RRID:Addgene_61002 Chloramphenicol acetyltransferase Other Ampicillin PMID:26781350 Backbone Marker:Ambion; Vector Backbone:pAMB; Vector Types:Unspecified; Bacterial Resistance:Ampicillin FspI site introduced after T7 terminator 2026-08-29 01:08:10 0
pUC-H1-gRNA
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61089 H1 promoter; gRNA sequences Homo sapiens Ampicillin PMID:25209046 As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site. Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin 2026-08-29 01:08:13 2
pUC19_TTE1564
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61000 TTE1564 transcript Thermoanaerobacter tengcongensis MB4 Ampicillin PMID:26781350 Backbone Size:2700; Vector Backbone:pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-08-29 01:08:12 1
SENP2M497A
 
Resource Report
Resource Website
RRID:Addgene_61088 SENP2M497A catalytic domain Homo sapiens Kanamycin PMID:23955022 Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin M497A; Catalytic domain is residues 364-589 2026-08-29 01:08:11 0
GB-NES
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61017 ddGFP B Synthetic Ampicillin PMID:25622108 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:11 4
GA-NES
 
Resource Report
Resource Website
RRID:Addgene_61018 ddGFP A Synthetic Ampicillin PMID:25622108 Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:13 0
psc2_md1
 
Resource Report
Resource Website
RRID:Addgene_61093 Mag genomic sequence Mus musculus Ampicillin PMID:23704325 Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:12 0
GPKAnes
 
Resource Report
Resource Website
RRID:Addgene_61092 pkac2 Cricetulus griseus Kanamycin PMID:12574406 The Y307H found in Addgene's QC sequence has no known functional consequence. Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:08:13 0
MBP-mmA1
 
Resource Report
Resource Website
RRID:Addgene_61090 hnRNP A1 Mus musculus Ampicillin PMID:23704325 Backbone Size:6700; Vector Backbone:pHMTC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:12 0
pDest27-mBIN1+17
 
Resource Report
Resource Website
RRID:Addgene_61096 mouse BIN1 with exon 17, excluding exon 7, 11, 13-16 Mus musculus Ampicillin PMID:24836577 Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:13 0
pBTR(hCc)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61026 horse cytochrome c Equus* Ampicillin PMID:11437597 Notes from depositor: CYC3 encodes the enzyme, which we call heme lysase in the paper, that covalently attaches the heme to the apocytochrome c. That is, the plasmid has BOTH the CYC3 gene and the structural gene for horse cytochrome c. The horse cytochrome C sequence has been codon optimized. Backbone Marker:Multiple labs; Vector Backbone:pBTR(C102T); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin *see comments 2026-08-29 01:08:12 2
pHT101-mCherry
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_61021 Ampicillin This vector can be used to create N- terminal or C-terminal mCherry tagged fusion proteins for expression in C. elegans. The mCherry and a modified MCS was inserted into the vector backbone using AgeI and EcoRI sites. See plasmid map and sequence for more information. Note that mCherry has been codon optimized for C. elegans expression. See pCFJ90 (Plasmid #19327) for details on the mCherry protein sequence. Backbone Marker:Andrew Fire (Addgene plasmid #1490); Backbone Size:4526; Vector Backbone:pPD95_67; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:13 2
DH10B-ALT
 
Resource Report
Resource Website
RRID:Addgene_61151 None PMID:23479654 In addition to the wt copy of lacI, another copy of lacI driven by PIq is integrated at the attB Contains another copy of araC driven by a constitutive promoter in addition to wt araC. Vector Backbone:NA; Vector Types:; Bacterial Resistance:None 2026-08-29 01:08:11 0
6his-WT gusA-pET28a+
 
Resource Report
Resource Website
RRID:Addgene_61156 gusA Escherichia coli Kanamycin PMID:10404164 Matsumura lab strain number 337 Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-08-29 01:08:13 0
pCRII HSPB7
 
Resource Report
Resource Website
RRID:Addgene_61034 HSPB7 Danio rerio Ampicillin PMID:18161059 linearize with NotI, transcribe with SP6, probe length is 519. Note: Addgene's quality control sequencing has found a few mismatches in the plasmid insert, but they should not affect its ability to be used as a probe. Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:11 0
pB194
 
Resource Report
Resource Website
RRID:Addgene_61154 TFIIH complex serine/threonine-protein kinase subunit KIN28 Saccharomyces cerevisiae Ampicillin PMID:11805111 Backbone Marker:Herren, B., and Pech, M. (1993) J. Recept. Res. 13, 725–738; Vector Backbone:pRS425Gal1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-29 01:08:13 0
pMTB-Multibow-hY
 
Resource Report
Resource Website
RRID:Addgene_60995 citrine Synthetic Ampicillin PMID:26010570 Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin 2026-08-29 01:08:10 0
pMTB-Multibow-hG
 
Resource Report
Resource Website
RRID:Addgene_60994 EGFP Synthetic Ampicillin PMID:26010570 Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin 2026-08-29 01:08:12 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.