Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
gRNA-hIRF-1 #12/pSIR Resource Report Resource Website |
RRID:Addgene_61080 | gRNA_hIRF1 promoter #12 | Homo sapiens | Ampicillin | PMID:25051498 | gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG | Backbone Marker:Clontech; Backbone Size:8083; Vector Backbone:pSIR; Vector Types:Mammalian Expression, Retroviral, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:13 | 0 | |
|
pDest27-mBIN1 Resource Report Resource Website |
RRID:Addgene_61086 | smallest constitutive BIN1excluding exon 7, 11, 13-17 | Mus musculus | Ampicillin | PMID:24836577 | Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:13 | 0 | ||
|
pAMB_CAT-FspI Resource Report Resource Website |
RRID:Addgene_61002 | Chloramphenicol acetyltransferase | Other | Ampicillin | PMID:26781350 | Backbone Marker:Ambion; Vector Backbone:pAMB; Vector Types:Unspecified; Bacterial Resistance:Ampicillin | FspI site introduced after T7 terminator | 2026-08-29 01:08:10 | 0 | |
|
pUC-H1-gRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_61089 | H1 promoter; gRNA sequences | Homo sapiens | Ampicillin | PMID:25209046 | As Ampicillin gene and H1 promoter contain BsaI sites, we mutated the sequence of Amp gene (G1601C, not change amino acid), and mutated H1 promoter from GAGACC to GAGGACC to eliminate the BsaI internal site. | Backbone Size:2636; Vector Backbone:pUC19; Vector Types:Mammalian Expression, CRISPR, /Cas9 gRNA cloning vector; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:13 | 2 | |
|
pUC19_TTE1564 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61000 | TTE1564 transcript | Thermoanaerobacter tengcongensis MB4 | Ampicillin | PMID:26781350 | Backbone Size:2700; Vector Backbone:pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:12 | 1 | ||
|
SENP2M497A Resource Report Resource Website |
RRID:Addgene_61088 | SENP2M497A catalytic domain | Homo sapiens | Kanamycin | PMID:23955022 | Backbone Marker:Novagen; Backbone Size:7328; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | M497A; Catalytic domain is residues 364-589 | 2026-08-29 01:08:11 | 0 | |
|
GB-NES Resource Report Resource Website 1+ mentions |
RRID:Addgene_61017 | ddGFP B | Synthetic | Ampicillin | PMID:25622108 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:11 | 4 | ||
|
GA-NES Resource Report Resource Website |
RRID:Addgene_61018 | ddGFP A | Synthetic | Ampicillin | PMID:25622108 | Backbone Size:5500; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:13 | 0 | ||
|
psc2_md1 Resource Report Resource Website |
RRID:Addgene_61093 | Mag genomic sequence | Mus musculus | Ampicillin | PMID:23704325 | Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psiCheck2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:12 | 0 | ||
|
GPKAnes Resource Report Resource Website |
RRID:Addgene_61092 | pkac2 | Cricetulus griseus | Kanamycin | PMID:12574406 | The Y307H found in Addgene's QC sequence has no known functional consequence. | Backbone Marker:Clontech; Backbone Size:4731; Vector Backbone:EGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:13 | 0 | |
|
MBP-mmA1 Resource Report Resource Website |
RRID:Addgene_61090 | hnRNP A1 | Mus musculus | Ampicillin | PMID:23704325 | Backbone Size:6700; Vector Backbone:pHMTC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:12 | 0 | ||
|
pDest27-mBIN1+17 Resource Report Resource Website |
RRID:Addgene_61096 | mouse BIN1 with exon 17, excluding exon 7, 11, 13-16 | Mus musculus | Ampicillin | PMID:24836577 | Backbone Marker:Life Technologies; Backbone Size:8123; Vector Backbone:pDEST27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:13 | 0 | ||
|
pBTR(hCc) Resource Report Resource Website 1+ mentions |
RRID:Addgene_61026 | horse cytochrome c | Equus* | Ampicillin | PMID:11437597 | Notes from depositor: CYC3 encodes the enzyme, which we call heme lysase in the paper, that covalently attaches the heme to the apocytochrome c. That is, the plasmid has BOTH the CYC3 gene and the structural gene for horse cytochrome c. The horse cytochrome C sequence has been codon optimized. | Backbone Marker:Multiple labs; Vector Backbone:pBTR(C102T); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | *see comments | 2026-08-29 01:08:12 | 2 |
|
pHT101-mCherry Resource Report Resource Website 1+ mentions |
RRID:Addgene_61021 | Ampicillin | This vector can be used to create N- terminal or C-terminal mCherry tagged fusion proteins for expression in C. elegans. The mCherry and a modified MCS was inserted into the vector backbone using AgeI and EcoRI sites. See plasmid map and sequence for more information. Note that mCherry has been codon optimized for C. elegans expression. See pCFJ90 (Plasmid #19327) for details on the mCherry protein sequence. | Backbone Marker:Andrew Fire (Addgene plasmid #1490); Backbone Size:4526; Vector Backbone:pPD95_67; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:13 | 2 | ||||
|
DH10B-ALT Resource Report Resource Website |
RRID:Addgene_61151 | None | PMID:23479654 | In addition to the wt copy of lacI, another copy of lacI driven by PIq is integrated at the attB Contains another copy of araC driven by a constitutive promoter in addition to wt araC. | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2026-08-29 01:08:11 | 0 | |||
|
6his-WT gusA-pET28a+ Resource Report Resource Website |
RRID:Addgene_61156 | gusA | Escherichia coli | Kanamycin | PMID:10404164 | Matsumura lab strain number 337 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a (+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:13 | 0 | |
|
pCRII HSPB7 Resource Report Resource Website |
RRID:Addgene_61034 | HSPB7 | Danio rerio | Ampicillin | PMID:18161059 | linearize with NotI, transcribe with SP6, probe length is 519. Note: Addgene's quality control sequencing has found a few mismatches in the plasmid insert, but they should not affect its ability to be used as a probe. | Vector Backbone:pCRII; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:11 | 0 | |
|
pB194 Resource Report Resource Website |
RRID:Addgene_61154 | TFIIH complex serine/threonine-protein kinase subunit KIN28 | Saccharomyces cerevisiae | Ampicillin | PMID:11805111 | Backbone Marker:Herren, B., and Pech, M. (1993) J. Recept. Res. 13, 725–738; Vector Backbone:pRS425Gal1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:13 | 0 | ||
|
pMTB-Multibow-hY Resource Report Resource Website |
RRID:Addgene_60995 | citrine | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:10 | 0 | |
|
pMTB-Multibow-hG Resource Report Resource Website |
RRID:Addgene_60994 | EGFP | Synthetic | Ampicillin | PMID:26010570 | Multibow constructs contain repetitive loxP sites that make these constructs prone to recombination. The constructs display a few issues with bacterial stability and sequencing that need to be considered when amplifying, storing and using them. First, in our hands Multibow constructs have displayed instability in E.coli cultures and had low yield in Maxi/Midi-preps. Mini-prep is recommended to harvest Multibow constructs. For transformation, we have had success with 5-alpha F'Iq cells (NEB). Second, the sequencing of Multibow constructs may run into problems of low quality/inaccurate reads. A problematic trace file does not necessarily mean the construct is wrong or the sample has mixed sequences. Third, before using the constructs harvested from mini-prep for injections, we recommend a further purification step using DNA purification kits such as MinElute PCR purification kit (Qiagen). All Multibow constructs share a backbone of pMTB vector (AMP resistance) containing the tol2 sites for transgenic insertion and the loxP recombination sites. To validate the variable region, we recommend sequencing with this specific primer: 5'-CAGCAGGACCATTTATCATGCTGCTGC-3', which recognizes the end of the variable region. The Sp6 primer may not provide enough reading length to reach the variable region. | Vector Backbone:pMTB; Vector Types:Zebrafish; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:12 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.