Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pET28a-SENP6 (catalytic domain) Resource Report Resource Website 1+ mentions |
RRID:Addgene_16359 | human SENP6 catalytic domain | Homo sapiens | Kanamycin | PMID:17591783 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Amino Acid 628 to 1112 catalytic domain of human SENP6. | 2026-08-15 01:09:13 | 1 | |
|
pET28a-SENP2 (catalytic domain) Resource Report Resource Website 1+ mentions |
RRID:Addgene_16357 | human SENP2 catalytic domain | Homo sapiens | Kanamycin | PMID:17591783 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Amino Acid 365 to 590 catalytic domain of human SENP2. | 2026-08-15 01:09:13 | 8 | |
|
pET28a-SENP1 (catalytic domain) Resource Report Resource Website 1+ mentions |
RRID:Addgene_16356 | human SENP1 catalytic domain | Homo sapiens | Kanamycin | PMID:17591783 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Amino Acid 419 to 644 catalytic domain of human SENP1. | 2026-08-15 01:09:13 | 2 | |
|
Dcp2 ΔH1 Δ5H Resource Report Resource Website |
RRID:Addgene_163582 | Dcp2 | Saccharomyces cerevisiae | Ampicillin | PMID:32553117 | Impaired Edc3 binding sites (first HLM, and 5 additional HLMs in C-terminal domain). 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG | Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | L255A; mutate 440-450, 489-500, 701-708, 827-831, and 935-938 to all alanines | 2026-08-15 01:09:13 | 0 |
|
Dcp2C Δ5H Resource Report Resource Website |
RRID:Addgene_163581 | Dcp2 | Saccharomyces cerevisiae | Ampicillin | PMID:32553117 | C-terminal domain (327-970) containing 5 impaired Edc3 binding sites (5 additional HLMs in C-terminal domain); N-terminal domain (1-299) including first HLM is removed. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG | Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Truncation of aa1-300; mutate aa440-450, aa489-500, aa701-708, aa827-831, and aa935-938 to all alanines | 2026-08-15 01:09:13 | 0 |
|
N-GFP-Dcp2 Resource Report Resource Website |
RRID:Addgene_163585 | Dcp2 | Saccharomyces cerevisiae | Ampicillin | PMID:32553117 | 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG | Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:13 | 0 | |
|
Dcp2 ΔH1 WD Resource Report Resource Website |
RRID:Addgene_163580 | Dcp2 | Saccharomyces cerevisiae | Ampicillin | PMID:32553117 | Impaired Edc3 binding site (first HLM); impaired RNA cap recognition site (W50, D54). 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG | Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | W50A, D54A, L255A | 2026-08-15 01:09:13 | 0 |
|
pGEX4T3-NL2CT Resource Report Resource Website |
RRID:Addgene_163623 | mouse NL2 | Mus musculus | Ampicillin | PMID:31775031 | Vector Backbone:pGEX4T3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:14 | 0 | ||
|
plenti_DCLK1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_163625 | DCLK1 | Homo sapiens | Ampicillin | PMID:32755567 | Please note that the Addgene NGS sequence differs from the depositor's annotated sequence. These differences do not affect plasmid function. | Vector Backbone:pLenti6; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:14 | 1 | |
|
plenti_DCLK1 G511N Resource Report Resource Website 1+ mentions |
RRID:Addgene_163626 | DCLK1 | Homo sapiens | Ampicillin | PMID:32755567 | Please note that the Addgene NGS sequence differs from the depositor's annotated sequence. These differences do not affect plasmid function. | Vector Backbone:pLenti6; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | G511N | 2026-08-15 01:09:14 | 1 |
|
p10xQUAS-CsChrimson Resource Report Resource Website 1+ mentions |
RRID:Addgene_163629 | CsChrimson.mVenus | Synthetic | Ampicillin | PMID:35442190 | Read the preprint on bioRxiv: https://www.biorxiv.org/content/10.1101/2020.11.07.355651v2 Also refer to: Klapoetke, N.C., Murata, Y., Kim, S.S., Pulver, S.R., Birdsey-Benson, A., Cho, Y.K., Morimoto, T.K., Chuong, A.S., Carpenter, E.J., Tian, Z., et al. (2014). Independent optical excitation of distinct neural populations. Nat Methods 11, 338-346. PMID: 24509633, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3943671/ | Backbone Marker:synthetic- Potter Lab; Backbone Size:8335; Vector Backbone:p10QUAS; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:14 | 2 | |
|
Dcp2 FL Resource Report Resource Website |
RRID:Addgene_163574 | Dcp2 | Saccharomyces cerevisiae | Ampicillin | PMID:32553117 | 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG | Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:13 | 0 | |
|
Dcp2 300 Resource Report Resource Website |
RRID:Addgene_163577 | Dcp2 | Saccharomyces cerevisiae | Ampicillin | PMID:32553117 | Lacking C-terminal domain. 5' sequencing primers: Dcp2-seq1b:CGAATTTTACGTCTGAGGAAAG. Dcp2-seq2b: gacatagattgttgcattag. Dcp2-seq3b: cttcagcatttgaaagagca Dcp2-seq4b:gcaaaacaataatgatgaaa Dcp2-seq5b: gagaacaatttccaagacgg. Dcp2-seq7:tgaaacgcaacgacgctaca Dcp2-seq8b: GATACCCAGATCATATGAAACG | Backbone Size:5827; Vector Backbone:pRP1903; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Truncation of C-terminal domian (301-970) | 2026-08-15 01:09:13 | 0 |
|
phCMV-GALV-MTR Resource Report Resource Website 1+ mentions |
RRID:Addgene_163612 | GaLV MTR envelope | Other | Ampicillin | PMID:31586074 | This plasmid was generated by modification of Addgene plasmid 15802 to excise ENV-Eco and replace with ENV GALV-MTR. | Backbone Marker:Addgene 15802; Backbone Size:4764; Vector Backbone:phCMV-ECO-ENV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:14 | 7 | |
|
MSCV-BCL2 Resource Report Resource Website |
RRID:Addgene_163611 | BCL2 | Homo sapiens | Ampicillin | PMID:31586074 | The huCD2 portion of the MSCV_IRES_huDC2 backbone was added by Dr Martin Turner, Babraham Institute, Cambridge by modification of Addgene plasmid # 27490. | Backbone Size:6574; Vector Backbone:MSCV_IRES_huDC2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:13 | 0 | |
|
pET28a-His6-ODC-Ctag Resource Report Resource Website 1+ mentions |
RRID:Addgene_163614 | ODC | Homo sapiens | Kanamycin | PMID:33514717 | Backbone Marker:Novagen; Backbone Size:5246; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:14 | 1 | ||
|
pET28a-His6-OAZ-GSY-SPM-Ctag Resource Report Resource Website |
RRID:Addgene_163613 | OAZ-GSY-SPM | Synthetic | Kanamycin | PMID:33514717 | Backbone Marker:Novagen; Backbone Size:5246; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:14 | 0 | ||
|
pET28a-TGFα-GSY-SPM Resource Report Resource Website |
RRID:Addgene_163615 | TGFa-GSY-SPM | Homo sapiens | Kanamycin | PMID:33514717 | Backbone Marker:Novagen; Backbone Size:5209; Vector Backbone:pET-28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:09:14 | 0 | ||
|
pWZ186 Resource Report Resource Website 1+ mentions |
RRID:Addgene_163641 | DHB:2xmKate2::3xHA | Synthetic | Ampicillin | PMID:33350383 | 2xmKate2 fusion of C. elegans codon-optimized DNA Helicase B (DHB) under the rps-27 promoter for ubiquitous expression. Plasmid is for CRISPR/Cas9-mediated single copy insertion at the ttTi4348 site on Chromosome I and can be paired with sgRNA plasmid pAP082 | Backbone Marker:Bob Goldstein/Ari Pani; Backbone Size:11926; Vector Backbone:pAP088; Vector Types:Worm Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:09:14 | 1 | |
|
Man2a1-myc Resource Report Resource Website |
RRID:Addgene_163648 | mannosidase alpha class 2A member 1 | Homo sapiens | Ampicillin | PMID:34533190 | Backbone Marker:Dr. Lu Lei's lab; Backbone Size:5523; Vector Backbone:pDmyc-neo-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Silent mutation was made to introduce a XbaI restriction site in Man2a1 | 2026-08-15 01:09:14 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
