Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: acta2
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17474123
Comments: Primers used to amplify cDNA:
CCCAGCACTGTCAGGTGATT and CCCATTCCTACCATCACTCC
acta2 promoter = A 300 bp proximal promoter for acta2 and 2165 bp fragment from the acta2 intron 1. The two genomic fragments were fused in a PCR reaction to make a 2465 bp enhancer/promoter construct
Acta2 3'UTR is in reverse orientation with t1440del, t1454c and a1578g compared to reference sequence. Depositor states that these discrepancies do not affect plasmid function.
Proper citation: RRID:Addgene_78711 Copy
Species: Danio rerio
Genetic Insert: Cerulean protein fused to zebrafish Rpl10a ribosomal unit
Vector Backbone Description: Backbone Size:6084; Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79880 Copy
Species: Danio rerio
Genetic Insert: HA-tagged BirA, 2A, mCherry protein and SV40 polyA, followed by FRT site-flanked Kanamycin selection gene
Vector Backbone Description: Backbone Size:2994; Vector Backbone:pGEM-T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79887 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:6903; Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79886 Copy
Species: Danio rerio
Genetic Insert: Cerulean protein fused to zebrafish Rpl10a ribosomal unit
Vector Backbone Description: Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79882 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:6903; Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_79885 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Vector Backbone:pMT; Vector Types:Bacterial Expression, zebrafish biotagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80059 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Vector Backbone:pMT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80058 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:5450; Vector Backbone:pMT; Vector Types:Bacterial Expression, zebrafish biotagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80065 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:5635; Vector Backbone:pMT; Vector Types:Bacterial Expression, zebrafish biotagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80063 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:5635; Vector Backbone:pMT; Vector Types:Bacterial Expression, zebrafish biotagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80062 Copy
Species: Danio rerio
Genetic Insert: Biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Vector Backbone Description: Backbone Size:5139; Vector Backbone:pMT; Vector Types:Bacterial Expression, zebrafish biotagging; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28402863
Proper citation: RRID:Addgene_80060 Copy
Species: Danio rerio
Genetic Insert: Daino rerio voltage-sensing phosphatase
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:18375390
Proper citation: RRID:Addgene_80331 Copy
Species: Danio rerio
Genetic Insert: rab7
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Comments: *Note: Compared to the Entrez Genbank entry for Rab7a, Addgene's quality control sequencing finds a D63G amino acid residue substitution. The effect of this residue change on protein function is unknown.
Proper citation: RRID:Addgene_80522 Copy
Species: Danio rerio
Genetic Insert: rab6ba transcript variant X1
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80520 Copy
Species: Danio rerio
Genetic Insert: rab27b
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80519 Copy
Species: Danio rerio
Genetic Insert: rab5aa
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Comments: *Note: Compared to the Entrez Genbank entry for Rab3ab, Addgene's quality control sequencing finds a Q216R amino acid residue substitution. The effect of this residue change on protein function is unknown.
Proper citation: RRID:Addgene_80515 Copy
Species: Danio rerio
Genetic Insert: rab4b
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Comments: *Note: Compared to the Entrez Genbank entry for Rab4b, Addgene's quality control sequencing finds a D126G amino acid residue substitution. The effect of this residue change on protein function is unknown. We also find a P170L SNP.
Proper citation: RRID:Addgene_80514 Copy
Species: Danio rerio
Genetic Insert: rab3db
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Proper citation: RRID:Addgene_80512 Copy
Species: Danio rerio
Genetic Insert: rab3da
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGemT easy; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28396820
Comments: *Note: Compared to the Entrez Genbank entry for Rab3da, Addgene's quality control sequencing finds an E180G amino acid residue substitution. The effect of this residue change on protein function is unknown.
Proper citation: RRID:Addgene_80511 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
