Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 47 showing 921 ~ 940 out of 740,017 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_35987

http://www.addgene.org/35987

Species: Rattus norvegicus
Genetic Insert: protein tyrosine phosphatase 1B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4407; Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18332219

Proper citation: RRID:Addgene_35987 Copy   


  • RRID:Addgene_35986

http://www.addgene.org/35986

Species: Danio rerio
Genetic Insert: Ncad
Vector Backbone Description: Backbone Marker:Dev Biol. 2001 May 15;233(2):329-46; Vector Backbone:pUAS-EGFP; Vector Types:Gal4 inducible; Bacterial Resistance:Kanamycin
Defining Citation: PMID:15483121

Proper citation: RRID:Addgene_35986 Copy   


http://www.addgene.org/35985

Genetic Insert: transactivating protein
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22817991

Proper citation: RRID:Addgene_35985 Copy   


http://www.addgene.org/36035

Species: Homo sapiens
Genetic Insert: CHOP promoter (-647 to +136)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4140; Vector Backbone:pmCherry-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22215663

Proper citation: RRID:Addgene_36035 Copy   


  • RRID:Addgene_36034

http://www.addgene.org/36034

Vector Backbone Description: Backbone Size:6881; Vector Backbone:pTAL5-BB; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22442681
Comments: For more information on Ellis TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#ellis

Proper citation: RRID:Addgene_36034 Copy   


  • RRID:Addgene_36033

http://www.addgene.org/36033

Vector Backbone Description: Backbone Marker:Addgene; Backbone Size:7530; Vector Backbone:pTAL3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22442681
Comments: For more information on Ellis TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#ellis

Proper citation: RRID:Addgene_36033 Copy   


  • RRID:Addgene_36027

http://www.addgene.org/36027

Vector Backbone Description: Backbone Size:6800; Vector Backbone:pDR195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17293878

Proper citation: RRID:Addgene_36027 Copy   


  • RRID:Addgene_36026

    This resource has 1+ mentions.

http://www.addgene.org/36026

Vector Backbone Description: Backbone Size:9100; Vector Backbone:pDRf1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17293878

Proper citation: RRID:Addgene_36026 Copy   


  • RRID:Addgene_36029

    This resource has 1+ mentions.

http://www.addgene.org/36029

Vector Backbone Description: Backbone Size:6400; Vector Backbone:pDR195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16407306

Proper citation: RRID:Addgene_36029 Copy   


  • RRID:Addgene_36251

    This resource has 1+ mentions.

http://www.addgene.org/36251

Vector Backbone Description: Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology, Mycobacteria replicating vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22279533
Comments: The plasmid is high copy in E. coli, but low copy in mycobacteria.

Proper citation: RRID:Addgene_36251 Copy   


  • RRID:Addgene_36250

    This resource has 1+ mentions.

http://www.addgene.org/36250

Species: Homo sapiens
Genetic Insert: WASp
Vector Backbone Description: Backbone Marker:Didier Trono; Backbone Size:6857; Vector Backbone:pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22431569

Proper citation: RRID:Addgene_36250 Copy   


http://www.addgene.org/36134

Species: Homo sapiens
Genetic Insert: cyclophilin B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22426501

Proper citation: RRID:Addgene_36134 Copy   


  • RRID:Addgene_36254

http://www.addgene.org/36254

Vector Backbone Description: Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22279533
Comments: The plasmid lacks the pAL5000 origin of replication and does not replicate in mycobacteria. This plasmid is related to pRiboS BsaHind, but is not reported in PMID 2227955333: Unlike pRiboS BsaHind, the original MCS is preserved, except that the BstBI site is lost.

Proper citation: RRID:Addgene_36254 Copy   


  • RRID:Addgene_36253

http://www.addgene.org/36253

Vector Backbone Description: Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology, Mycobacteria replicating vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22279533
Comments: The plasmid lacks the pAL5000 origin of replication and does not replicate in mycobacteria.

Proper citation: RRID:Addgene_36253 Copy   


  • RRID:Addgene_36246

    This resource has 1+ mentions.

http://www.addgene.org/36246

Genetic Insert: Two copies of the Brachyury T-box site
Vector Backbone Description: Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22354841
Comments: Brachyury palindromic element: AATTTCACACCTAGGTGTGAAATT

Proper citation: RRID:Addgene_36246 Copy   


  • RRID:Addgene_36245

    This resource has 1+ mentions.

http://www.addgene.org/36245

Genetic Insert: Two copies of the Brachyury T-box site
Vector Backbone Description: Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22354841
Comments: Mutated Brachyury palindromic element: AATTTGGGACCTAGGTCCCAAATT

Proper citation: RRID:Addgene_36245 Copy   


  • RRID:Addgene_36242

http://www.addgene.org/36242

Genetic Insert: yEHA
Vector Backbone Description: Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4872; Vector Backbone:pBS35; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760

Proper citation: RRID:Addgene_36242 Copy   


  • RRID:Addgene_36238

http://www.addgene.org/36238

Genetic Insert: TRP1
Vector Backbone Description: Vector Backbone:pCY 3120-01; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Comments: The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function.

Proper citation: RRID:Addgene_36238 Copy   


  • RRID:Addgene_36196

    This resource has 1+ mentions.

http://www.addgene.org/36196

Species: Homo sapiens
Genetic Insert: DOT1L (GeneScript Synthesized)
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 3SX0. http://www.thesgc.org/structures/3SX0/ PDB: 5JUW. http://www.thesgc.org/structures/5JUW/

Proper citation: RRID:Addgene_36196 Copy   


  • RRID:Addgene_36233

http://www.addgene.org/36233

Genetic Insert: URA3
Vector Backbone Description: Vector Backbone:pCY 3090-02; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22473760
Comments: The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function.

Proper citation: RRID:Addgene_36233 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X