Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Authority:addgene (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

177,820 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pTrcHisA-rat-PTP1B
 
Resource Report
Resource Website 		RRID:Addgene_35987 protein tyrosine phosphatase 1B Rattus norvegicus Ampicillin PMID:18332219 Backbone Marker:Invitrogen; Backbone Size:4407; Vector Backbone:pTrcHis A; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:04 0
pUAS-Ncad-GFP
 
Resource Report
Resource Website 		RRID:Addgene_35986 Ncad Danio rerio Kanamycin PMID:15483121 Backbone Marker:Dev Biol. 2001 May 15;233(2):329-46; Vector Backbone:pUAS-EGFP; Vector Types:Gal4 inducible; Bacterial Resistance:Kanamycin 2026-08-15 01:14:08 0
pcDNA3.1-TAT-1-101-FLAG basic mutant
 
Resource Report
Resource Website 		RRID:Addgene_35985 transactivating protein Ampicillin PMID:22817991 Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin tat from HIV1, 101 aa; R to A mutations at aa 56, 57, 59-61 2026-08-15 01:14:04 0
CHOP promoter (-649/+136) pmCherry-1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36035 CHOP promoter (-647 to +136) Homo sapiens Kanamycin PMID:22215663 Backbone Marker:Clontech; Backbone Size:4140; Vector Backbone:pmCherry-1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:08 7
pTAL6-BB
 
Resource Report
Resource Website 		RRID:Addgene_36034 Ampicillin PMID:22442681 For more information on Ellis TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#ellis Backbone Size:6881; Vector Backbone:pTAL5-BB; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 0
pTAL5-BB
 
Resource Report
Resource Website 		RRID:Addgene_36033 Ampicillin PMID:22442681 For more information on Ellis TALEN Add-On Plasmids please refer to: http://www.addgene.org/TALeffector/goldengate/add-ons/#ellis Backbone Marker:Addgene; Backbone Size:7530; Vector Backbone:pTAL3; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 0
pDRf1
 
Resource Report
Resource Website 		RRID:Addgene_36027 Ampicillin PMID:17293878 Backbone Size:6800; Vector Backbone:pDR195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:05 0
pDRf1-GW
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36026 Ampicillin PMID:17293878 Backbone Size:9100; Vector Backbone:pDRf1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 1
pDR196
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36029 Ampicillin PMID:16407306 Backbone Size:6400; Vector Backbone:pDR195; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:08 4
pRibo BsaHind
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36251 Kanamycin PMID:22279533 The plasmid is high copy in E. coli, but low copy in mycobacteria. Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology, Mycobacteria replicating vector; Bacterial Resistance:Kanamycin 2026-08-15 01:14:09 1
pRRL WS1.6 WASp
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36250 WASp Homo sapiens Ampicillin PMID:22431569 Backbone Marker:Didier Trono; Backbone Size:6857; Vector Backbone:pRRLSIN.cppt.PGK-GFP.WPRE Addgene 12252; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-08-15 01:14:06 1
PcDNA-DEST47-CypB-Del2 C-term GFP
 
Resource Report
Resource Website 		RRID:Addgene_36134 cyclophilin B Homo sapiens Ampicillin PMID:22426501 Backbone Marker:Invitrogen; Backbone Size:7780; Vector Backbone:pcDNA-DEST47; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin contains amino acids 38-216 of cyclophilin B 2026-08-15 01:14:05 0
pRiboS EcoHind
 
Resource Report
Resource Website 		RRID:Addgene_36254 Kanamycin PMID:22279533 The plasmid lacks the pAL5000 origin of replication and does not replicate in mycobacteria. This plasmid is related to pRiboS BsaHind, but is not reported in PMID 2227955333: Unlike pRiboS BsaHind, the original MCS is preserved, except that the BstBI site is lost. Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:14:09 0
pRiboS BsaHind
 
Resource Report
Resource Website 		RRID:Addgene_36253 Kanamycin PMID:22279533 The plasmid lacks the pAL5000 origin of replication and does not replicate in mycobacteria. Backbone Marker:Stover et al., 1991 Nature 351:456; Vector Backbone:pMV261; Vector Types:Bacterial Expression, Synthetic Biology, Mycobacteria replicating vector; Bacterial Resistance:Kanamycin 2026-08-15 01:14:06 0
TBRE-TK-Luc-WT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36246 Two copies of the Brachyury T-box site Ampicillin PMID:22354841 Brachyury palindromic element: AATTTCACACCTAGGTGTGAAATT Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:06 2
TBRE-TK-Luc-MUT
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36245 Two copies of the Brachyury T-box site Ampicillin PMID:22354841 Mutated Brachyury palindromic element: AATTTGGGACCTAGGTCCCAAATT Backbone Size:6800; Vector Backbone:pTK-luc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Mutations in the Brachyury palindromic element:CAC-->GGG and GTG-->CCC 2026-08-15 01:14:09 2
pCY 3140-02
 
Resource Report
Resource Website 		RRID:Addgene_36242 yEHA Ampicillin PMID:22473760 Backbone Marker:Yeast Resource Center, University of Washington; Backbone Size:4872; Vector Backbone:pBS35; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin 2026-08-15 01:14:06 0
pCY 3120-04
 
Resource Report
Resource Website 		RRID:Addgene_36238 TRP1 Ampicillin PMID:22473760 The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function. Vector Backbone:pCY 3120-01; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin 2026-08-15 01:14:06 0
DOT1L
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_36196 DOT1L (GeneScript Synthesized) Homo sapiens Kanamycin PDB: 3SX0. http://www.thesgc.org/structures/3SX0/ PDB: 5JUW. http://www.thesgc.org/structures/5JUW/ Backbone Marker:SGC; Backbone Size:7325; Vector Backbone:pET28-MHL (Addgene plasmid 26096); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin contains amino acid residues 1-420 2026-08-15 01:14:06 2
pCY 3090-06
 
Resource Report
Resource Website 		RRID:Addgene_36233 URA3 Ampicillin PMID:22473760 The minor discrepancies between the Addgene and author's sequence do not affect the plasmid function. Vector Backbone:pCY 3090-02; Vector Types:Yeast cassette for PCR and homologous recombination; Bacterial Resistance:Ampicillin 2026-08-15 01:14:06 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch