Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-arap3a-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGGCAACAATCGGTCCGT
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41200 Copy
Species: Homo sapiens
Genetic Insert: Rootletin
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16203858
Comments: The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing.
Proper citation: RRID:Addgene_41166 Copy
Species: Homo sapiens
Genetic Insert: PICH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17218258
Comments: The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning.
Proper citation: RRID:Addgene_41163 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ghsrb-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGGACAAACGTGTCCATC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41260 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ghsrb-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGTTCTCAGCGCATAAAG
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41261 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ghsra-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGCAGTTGAAGGAACAGT
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41259 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ghsra-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCTCTCAGCATGCCTACC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41258 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-gbas-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCGCCGATCTGAGAGAAG
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41257 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-gata2b-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGTCCAGTAAAGGAAGAC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41255 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-gata2b-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCAATGTGTCGACCTCAC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41254 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-gabrg2-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGGGAGTCAGAACCCAT
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41253 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-fascin-2b-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGCCCTCCAATGGCAGCA
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41248 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-fan1-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCTCCAACACAGCCTCAA
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41247 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-fan1-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGCCTTATTATCTGCGA
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41246 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ets1a-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGTTTGTGTTTTCTCCA
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41245 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-elk1-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTACATTGTGGCAGTTCC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41240 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-egfl7-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGGTGATGTCTGGAGTC
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41238 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ednrb1b-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTCCCAGCATGCCGAGCA
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41237 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ahcyl1-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGACAGACTGTGGCGAGG
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41192 Copy
Species: Danio rerio
Genetic Insert: ZebrafishCommunity-dazl-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TATGAAGGTGGATGAGAA
It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.
Proper citation: RRID:Addgene_41234 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
