Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
TAL3026 Resource Report Resource Website |
RRID:Addgene_41200 | ZebrafishCommunity-arap3a-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGGCAACAATCGGTCCGT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 0 | |
|
pEGFP Rootletin (Nigg pFL2(CW499)) Resource Report Resource Website 1+ mentions |
RRID:Addgene_41166 | Rootletin | Homo sapiens | Kanamycin | PMID:16203858 | The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing. | Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:42 | 5 | |
|
pEGFP PICH (Nigg CB62) Resource Report Resource Website 1+ mentions |
RRID:Addgene_41163 | PICH | Homo sapiens | Kanamycin | PMID:17218258 | The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning. | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:42 | 5 | |
|
TAL3086 Resource Report Resource Website |
RRID:Addgene_41260 | ZebrafishCommunity-ghsrb-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGGACAAACGTGTCCATC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3087 Resource Report Resource Website |
RRID:Addgene_41261 | ZebrafishCommunity-ghsrb-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGTTCTCAGCGCATAAAG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3085 Resource Report Resource Website |
RRID:Addgene_41259 | ZebrafishCommunity-ghsra-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGCAGTTGAAGGAACAGT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3084 Resource Report Resource Website |
RRID:Addgene_41258 | ZebrafishCommunity-ghsra-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCTCTCAGCATGCCTACC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3083 Resource Report Resource Website |
RRID:Addgene_41257 | ZebrafishCommunity-gbas-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCGCCGATCTGAGAGAAG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3081 Resource Report Resource Website |
RRID:Addgene_41255 | ZebrafishCommunity-gata2b-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGTCCAGTAAAGGAAGAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3080 Resource Report Resource Website |
RRID:Addgene_41254 | ZebrafishCommunity-gata2b-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCAATGTGTCGACCTCAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3079 Resource Report Resource Website |
RRID:Addgene_41253 | ZebrafishCommunity-gabrg2-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTGGGAGTCAGAACCCAT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3074 Resource Report Resource Website |
RRID:Addgene_41248 | ZebrafishCommunity-fascin-2b-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGCCCTCCAATGGCAGCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3073 Resource Report Resource Website |
RRID:Addgene_41247 | ZebrafishCommunity-fan1-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TCTCCAACACAGCCTCAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3072 Resource Report Resource Website |
RRID:Addgene_41246 | ZebrafishCommunity-fan1-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTGCCTTATTATCTGCGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3071 Resource Report Resource Website 1+ mentions |
RRID:Addgene_41245 | ZebrafishCommunity-ets1a-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTGTTTGTGTTTTCTCCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 1 | |
|
TAL3066 Resource Report Resource Website |
RRID:Addgene_41240 | ZebrafishCommunity-elk1-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTACATTGTGGCAGTTCC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3064 Resource Report Resource Website |
RRID:Addgene_41238 | ZebrafishCommunity-egfl7-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTGGTGATGTCTGGAGTC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3063 Resource Report Resource Website |
RRID:Addgene_41237 | ZebrafishCommunity-ednrb1b-Right | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TTCCCAGCATGCCGAGCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 | |
|
TAL3018 Resource Report Resource Website |
RRID:Addgene_41192 | ZebrafishCommunity-ahcyl1-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TGACAGACTGTGGCGAGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:42 | 0 | |
|
TAL3060 Resource Report Resource Website |
RRID:Addgene_41234 | ZebrafishCommunity-dazl-Left | Danio rerio | Ampicillin | PMID:21822241 | Target binding site: TATGAAGGTGGATGAGAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. | Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:43 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.