Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
TAL3026
 
Resource Report
Resource Website
RRID:Addgene_41200 ZebrafishCommunity-arap3a-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TGGCAACAATCGGTCCGT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:42 0
pEGFP Rootletin (Nigg pFL2(CW499))
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41166 Rootletin Homo sapiens Kanamycin PMID:16203858 The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing. Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 5
pEGFP PICH (Nigg CB62)
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41163 PICH Homo sapiens Kanamycin PMID:17218258 The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning. Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:42 5
TAL3086
 
Resource Report
Resource Website
RRID:Addgene_41260 ZebrafishCommunity-ghsrb-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TGGACAAACGTGTCCATC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3087
 
Resource Report
Resource Website
RRID:Addgene_41261 ZebrafishCommunity-ghsrb-Right Danio rerio Ampicillin PMID:21822241 Target binding site: TGTTCTCAGCGCATAAAG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3085
 
Resource Report
Resource Website
RRID:Addgene_41259 ZebrafishCommunity-ghsra-Right Danio rerio Ampicillin PMID:21822241 Target binding site: TGCAGTTGAAGGAACAGT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3084
 
Resource Report
Resource Website
RRID:Addgene_41258 ZebrafishCommunity-ghsra-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TCTCTCAGCATGCCTACC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3083
 
Resource Report
Resource Website
RRID:Addgene_41257 ZebrafishCommunity-gbas-Right Danio rerio Ampicillin PMID:21822241 Target binding site: TCGCCGATCTGAGAGAAG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3081
 
Resource Report
Resource Website
RRID:Addgene_41255 ZebrafishCommunity-gata2b-Right Danio rerio Ampicillin PMID:21822241 Target binding site: TGTCCAGTAAAGGAAGAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3080
 
Resource Report
Resource Website
RRID:Addgene_41254 ZebrafishCommunity-gata2b-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TCAATGTGTCGACCTCAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3079
 
Resource Report
Resource Website
RRID:Addgene_41253 ZebrafishCommunity-gabrg2-Right Danio rerio Ampicillin PMID:21822241 Target binding site: TTGGGAGTCAGAACCCAT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3074
 
Resource Report
Resource Website
RRID:Addgene_41248 ZebrafishCommunity-fascin-2b-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TGCCCTCCAATGGCAGCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3073
 
Resource Report
Resource Website
RRID:Addgene_41247 ZebrafishCommunity-fan1-Right Danio rerio Ampicillin PMID:21822241 Target binding site: TCTCCAACACAGCCTCAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3072
 
Resource Report
Resource Website
RRID:Addgene_41246 ZebrafishCommunity-fan1-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TTGCCTTATTATCTGCGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3071
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_41245 ZebrafishCommunity-ets1a-Right Danio rerio Ampicillin PMID:21822241 Target binding site: TTGTTTGTGTTTTCTCCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 1
TAL3066
 
Resource Report
Resource Website
RRID:Addgene_41240 ZebrafishCommunity-elk1-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TTACATTGTGGCAGTTCC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3064
 
Resource Report
Resource Website
RRID:Addgene_41238 ZebrafishCommunity-egfl7-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TTGGTGATGTCTGGAGTC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3063
 
Resource Report
Resource Website
RRID:Addgene_41237 ZebrafishCommunity-ednrb1b-Right Danio rerio Ampicillin PMID:21822241 Target binding site: TTCCCAGCATGCCGAGCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0
TAL3018
 
Resource Report
Resource Website
RRID:Addgene_41192 ZebrafishCommunity-ahcyl1-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TGACAGACTGTGGCGAGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:42 0
TAL3060
 
Resource Report
Resource Website
RRID:Addgene_41234 ZebrafishCommunity-dazl-Left Danio rerio Ampicillin PMID:21822241 Target binding site: TATGAAGGTGGATGAGAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb. Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin 2026-08-15 01:14:43 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.