Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 470 showing 9381 ~ 9400 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_41200

http://www.addgene.org/41200

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-arap3a-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGGCAACAATCGGTCCGT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41200 Copy   


http://www.addgene.org/41166

Species: Homo sapiens
Genetic Insert: Rootletin
Vector Backbone Description: Backbone Marker:Modified from Clontech; Backbone Size:4700; Vector Backbone:pCJW201 (modified pEGFP-C1); Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16203858
Comments: The partial cDNA clones KIAA0445 (Kazusa DNA Research Institute) and IMAGE clone 6150861 (Deutsches Ressourcenzentrum fuer Genomforschung GmbH) were fused, and the complete coding sequence for rootletin was cloned into pBluescript II SK- (Addgene plasmid #41168) and subsequently subcloned into pEGFP-C1 (CLONTECH Laboratories, Inc.). All constructs were confirmed by sequencing.

Proper citation: RRID:Addgene_41166 Copy   


  • RRID:Addgene_41163

    This resource has 1+ mentions.

http://www.addgene.org/41163

Species: Homo sapiens
Genetic Insert: PICH
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:17218258
Comments: The complete ORF of PICH (corresponding exactly to FLJ20105; Acc. No. BC111486) was amplified by nested PCR, using a HeLa Marathon library (Clontech laboratories Inc.), and cloned into pEGFP-C1 vector (Clontech laboratories Inc.). The following primer pairs were used: primer pair 1: AAG CTC CAG CTC CAA GCT CC and TGC TTT TTG AGA TCT TTC TTG CC, primer pair 2: GACTCGAGCTATGGAGGCATCCCGAAGGTTTC and GCCCGGGTCAATTGTTATTAAGTTGC. These primers contain Xho1 and Xma1 sites, respectively, used for cloning.

Proper citation: RRID:Addgene_41163 Copy   


  • RRID:Addgene_41260

http://www.addgene.org/41260

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ghsrb-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGGACAAACGTGTCCATC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41260 Copy   


  • RRID:Addgene_41261

http://www.addgene.org/41261

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ghsrb-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGTTCTCAGCGCATAAAG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41261 Copy   


  • RRID:Addgene_41259

http://www.addgene.org/41259

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ghsra-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGCAGTTGAAGGAACAGT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41259 Copy   


  • RRID:Addgene_41258

http://www.addgene.org/41258

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ghsra-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCTCTCAGCATGCCTACC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41258 Copy   


  • RRID:Addgene_41257

http://www.addgene.org/41257

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-gbas-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCGCCGATCTGAGAGAAG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41257 Copy   


  • RRID:Addgene_41255

http://www.addgene.org/41255

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-gata2b-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGTCCAGTAAAGGAAGAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41255 Copy   


  • RRID:Addgene_41254

http://www.addgene.org/41254

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-gata2b-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCAATGTGTCGACCTCAC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41254 Copy   


  • RRID:Addgene_41253

http://www.addgene.org/41253

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-gabrg2-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32290; Backbone Size:6447; Vector Backbone:JDS78; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGGGAGTCAGAACCCAT It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41253 Copy   


  • RRID:Addgene_41248

http://www.addgene.org/41248

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-fascin-2b-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGCCCTCCAATGGCAGCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41248 Copy   


  • RRID:Addgene_41247

http://www.addgene.org/41247

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-fan1-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TCTCCAACACAGCCTCAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41247 Copy   


  • RRID:Addgene_41246

http://www.addgene.org/41246

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-fan1-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGCCTTATTATCTGCGA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41246 Copy   


  • RRID:Addgene_41245

    This resource has 1+ mentions.

http://www.addgene.org/41245

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ets1a-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGTTTGTGTTTTCTCCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41245 Copy   


  • RRID:Addgene_41240

http://www.addgene.org/41240

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-elk1-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTACATTGTGGCAGTTCC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41240 Copy   


  • RRID:Addgene_41238

http://www.addgene.org/41238

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-egfl7-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32287; Backbone Size:6447; Vector Backbone:JDS71; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTGGTGATGTCTGGAGTC It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41238 Copy   


  • RRID:Addgene_41237

http://www.addgene.org/41237

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ednrb1b-Right
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TTCCCAGCATGCCGAGCA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41237 Copy   


  • RRID:Addgene_41192

http://www.addgene.org/41192

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-ahcyl1-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32288; Backbone Size:6447; Vector Backbone:JDS74; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TGACAGACTGTGGCGAGG It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41192 Copy   


  • RRID:Addgene_41234

http://www.addgene.org/41234

Species: Danio rerio
Genetic Insert: ZebrafishCommunity-dazl-Left
Vector Backbone Description: Backbone Marker:Addgene plasmid #32285; Backbone Size:6447; Vector Backbone:JDS70; Vector Types:Mammalian Expression, T7; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21822241
Comments: Target binding site: TATGAAGGTGGATGAGAA It is strongly recommended that users perform a diagnostic digest to verify this plasmid prior to use. For example, a double digest of the plasmid with BamHI and KpnI should result in two bands at 2.3kb and 5.8kb.

Proper citation: RRID:Addgene_41234 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X