Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 472 showing 9421 ~ 9440 out of 740,584 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_61264

    This resource has 1+ mentions.

http://www.addgene.org/61264

Genetic Insert: Ptac-dTomato
Vector Backbone Description: Vector Backbone:pAWP78; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25548049
Comments: dTomato reference: Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., & Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnology, 22(12), 1567–1572. doi:10.1038/nbt1037

Proper citation: RRID:Addgene_61264 Copy   


  • RRID:Addgene_61263

    This resource has 1+ mentions.

http://www.addgene.org/61263

Vector Backbone Description: Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25548049
Comments: In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'): AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA

Proper citation: RRID:Addgene_61263 Copy   


  • RRID:Addgene_61313

    This resource has 1+ mentions.

http://www.addgene.org/61313

Species: Synthetic
Genetic Insert: QF2w
Vector Backbone Description: Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61313 Copy   


http://www.addgene.org/61311

Species: Synthetic
Genetic Insert: LexA_DBD::QF2w_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61311 Copy   


  • RRID:Addgene_61271

http://www.addgene.org/61271

Species: Streptococcus pyogenes
Genetic Insert: Cas9, tracrRNA, crRNA
Vector Backbone Description: Vector Backbone:Custom pR1162-CmR; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25240928

Proper citation: RRID:Addgene_61271 Copy   


  • RRID:Addgene_61277

    This resource has 1+ mentions.

http://www.addgene.org/61277

Species: Homo sapiens
Genetic Insert: MBNL1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_61277 Copy   


http://www.addgene.org/61310

Species: Synthetic
Genetic Insert: LexA_DBD::QF2_AD
Vector Backbone Description: Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25581800
Comments: Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system.

Proper citation: RRID:Addgene_61310 Copy   


  • RRID:Addgene_61276

    This resource has 1+ mentions.

http://www.addgene.org/61276

Species: Homo sapiens
Genetic Insert: CUG-BP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_61276 Copy   


  • RRID:Addgene_61275

    This resource has 1+ mentions.

http://www.addgene.org/61275

Species: Homo sapiens
Genetic Insert: NOVA1
Vector Backbone Description: Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin

Proper citation: RRID:Addgene_61275 Copy   


  • RRID:Addgene_61204

http://www.addgene.org/61204

Genetic Insert: LC3(ATG8)
Vector Backbone Description: Backbone Marker:VIB; Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881

Proper citation: RRID:Addgene_61204 Copy   


  • RRID:Addgene_61202

http://www.addgene.org/61202

Genetic Insert: mCherry-SKL
Vector Backbone Description: Backbone Marker:VIB; Vector Backbone:pKm43GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881

Proper citation: RRID:Addgene_61202 Copy   


  • RRID:Addgene_61207

    This resource has 1+ mentions.

http://www.addgene.org/61207

Genetic Insert: AtPDLP1
Vector Backbone Description: Backbone Marker:VIB; Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:25329881

Proper citation: RRID:Addgene_61207 Copy   


  • RRID:Addgene_61280

    This resource has 1+ mentions.

http://www.addgene.org/61280

Species: Danio rerio
Genetic Insert: Slit1b
Vector Backbone Description: Backbone Marker:Stratagene; Vector Backbone:pBSII SK(+); Vector Types:cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14579375
Comments: antisense probe: cut with SmaI and use T7.

Proper citation: RRID:Addgene_61280 Copy   


  • RRID:Addgene_61284

    This resource has 1+ mentions.

http://www.addgene.org/61284

Vector Backbone Description: Backbone Size:4653; Vector Backbone:pBAD18; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25326321

Proper citation: RRID:Addgene_61284 Copy   


  • RRID:Addgene_61286

    This resource has 1+ mentions.

http://www.addgene.org/61286

Species: Mus musculus
Genetic Insert: IL-6 promoter
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12626566

Proper citation: RRID:Addgene_61286 Copy   


  • RRID:Addgene_61336

http://www.addgene.org/61336

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61336 Copy   


  • RRID:Addgene_61335

http://www.addgene.org/61335

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61335 Copy   


  • RRID:Addgene_61333

http://www.addgene.org/61333

Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923

Proper citation: RRID:Addgene_61333 Copy   


  • RRID:Addgene_61347

    This resource has 1+ mentions.

http://www.addgene.org/61347

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.

Proper citation: RRID:Addgene_61347 Copy   


  • RRID:Addgene_61346

    This resource has 1+ mentions.

http://www.addgene.org/61346

Species: Synthetic
Genetic Insert: mCherry
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25019686
Comments: Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing.

Proper citation: RRID:Addgene_61346 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X