Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAWP89 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61264 | Ptac-dTomato | Kanamycin | PMID:25548049 | dTomato reference: Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., & Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnology, 22(12), 1567–1572. doi:10.1038/nbt1037 | Vector Backbone:pAWP78; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:14 | 2 | ||
|
pAWP78 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61263 | Kanamycin | PMID:25548049 | In order to use plasmid pAWP78, inserts should be added by Gibson Cloning. Primers to amplify the backbone have been annotated on the depositor's plasmid map. The sequences are (5' to 3'): AP259_pAWP78_fwd1 - TTGTCGGGAAGATGCGTGAT AP254_pAWP78_rev1 - CAGCTCACTCAAAGGCGGTA | Backbone Size:4979; Vector Backbone:pCM66; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:15 | 2 | |||
|
pQF2wWB Resource Report Resource Website 1+ mentions |
RRID:Addgene_61313 | QF2w | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Vector Backbone:pGAWB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:15 | 2 | |
|
pCaSpeR-act5cB-LexAQFw Resource Report Resource Website |
RRID:Addgene_61311 | LexA_DBD::QF2w_AD | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | Changed EK on C-terminus of QF2 to KKKK | 2026-08-29 01:08:14 | 0 |
|
pMM441 Resource Report Resource Website |
RRID:Addgene_61271 | Cas9, tracrRNA, crRNA | Streptococcus pyogenes | Chloramphenicol | PMID:25240928 | Vector Backbone:Custom pR1162-CmR; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol | 2026-08-29 01:08:15 | 0 | ||
|
pDest eGFP MBNL1 42 kDa Resource Report Resource Website 1+ mentions |
RRID:Addgene_61277 | MBNL1 | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Vector Backbone:pDEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:14 | 2 | |||
|
pCaSpeR-act5cB-LexAQF Resource Report Resource Website |
RRID:Addgene_61310 | LexA_DBD::QF2_AD | Synthetic | Ampicillin | PMID:25581800 | Please see this additional reference https://www.ncbi.nlm.nih.gov/pubmed/20434990 for more information on the Q-system. | Vector Backbone:pCaSpeR; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:15 | 0 | |
|
pDest eGFP CUGBP1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61276 | CUG-BP | Homo sapiens | Ampicillin | Backbone Marker:Invitrogen; Vector Backbone:pDEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:15 | 1 | |||
|
NOVA1 eGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_61275 | NOVA1 | Homo sapiens | Ampicillin | Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:13 | 2 | |||
|
pCMU-AUTr Resource Report Resource Website |
RRID:Addgene_61204 | LC3(ATG8) | Spectinomycin | PMID:25329881 | Backbone Marker:VIB; Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:08:12 | 0 | |||
|
pCMU-PERr Resource Report Resource Website |
RRID:Addgene_61202 | mCherry-SKL | Spectinomycin | PMID:25329881 | Backbone Marker:VIB; Vector Backbone:pKm43GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:08:14 | 0 | |||
|
pCMB-PDESr Resource Report Resource Website 1+ mentions |
RRID:Addgene_61207 | AtPDLP1 | Spectinomycin | PMID:25329881 | Backbone Marker:VIB; Vector Backbone:pK7m34GW; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin | 2026-08-29 01:08:12 | 1 | |||
|
Zf Slit1b Resource Report Resource Website 1+ mentions |
RRID:Addgene_61280 | Slit1b | Danio rerio | Ampicillin | PMID:14579375 | antisense probe: cut with SmaI and use T7. | Backbone Marker:Stratagene; Vector Backbone:pBSII SK(+); Vector Types:cloning vector; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:15 | 1 | |
|
pcrRNA.ind Resource Report Resource Website 1+ mentions |
RRID:Addgene_61284 | Ampicillin | PMID:25326321 | Backbone Size:4653; Vector Backbone:pBAD18; Vector Types:Bacterial Expression, CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:14 | 2 | ||||
|
pmIL-6 FL Resource Report Resource Website 1+ mentions |
RRID:Addgene_61286 | IL-6 promoter | Mus musculus | Ampicillin | PMID:12626566 | Backbone Marker:Promega; Vector Backbone:pGL2 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:15 | 8 | ||
|
pCri-15b Resource Report Resource Website |
RRID:Addgene_61336 | Green fluorescent protein | Bleocin (Zeocin) | PMID:25386923 | Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2026-08-29 01:08:13 | 0 | |||
|
pCri-14b Resource Report Resource Website |
RRID:Addgene_61335 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:15 | 0 | |||
|
pCri-11b Resource Report Resource Website |
RRID:Addgene_61333 | Green fluorescent protein | Kanamycin | PMID:25386923 | Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:08:13 | 0 | |||
|
pDN77 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61347 | mCherry | Synthetic | Ampicillin | PMID:25019686 | Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:15 | 4 | |
|
pDN43 Resource Report Resource Website 1+ mentions |
RRID:Addgene_61346 | mCherry | Synthetic | Ampicillin | PMID:25019686 | Please note that the mammalian selection marker in the vector backbone for this plasmid has not been verified by sequencing. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:08:15 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.