Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 474 showing 9461 ~ 9480 out of 12,978 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_163598

http://www.addgene.org/163598

Species: Mus musculus
Genetic Insert: Gdf6
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163598 Copy   


  • RRID:Addgene_163591

http://www.addgene.org/163591

Species: Mus musculus
Genetic Insert: Bmp7
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163591 Copy   


  • RRID:Addgene_163590

    This resource has 1+ mentions.

http://www.addgene.org/163590

Species: Mus musculus
Genetic Insert: Bmp6
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163590 Copy   


  • RRID:Addgene_163517

    This resource has 1+ mentions.

http://www.addgene.org/163517

Species: Mus musculus
Genetic Insert: murine-IFN gamma
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCIneo; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Plasmid created by Ananda Mookerjee and Thomas Weber

Proper citation: RRID:Addgene_163517 Copy   


  • RRID:Addgene_163519

http://www.addgene.org/163519

Species: Mus musculus
Genetic Insert: murine-FLT3L variant 1
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pTRIP-Puro-2A; Vector Types:Mammalian Expression, Bacterial Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: Plasmid created by Ananda Mookerjee and Thomas Weber

Proper citation: RRID:Addgene_163519 Copy   


  • RRID:Addgene_163518

http://www.addgene.org/163518

Species: Mus musculus
Genetic Insert: murine GM-CSF
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pCIneo; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: Created by Ananda Mookerjee and Thomas Weber

Proper citation: RRID:Addgene_163518 Copy   


http://www.addgene.org/163704

Species: Mus musculus
Genetic Insert: mirMecp2 and EGFP
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33046553

Proper citation: RRID:Addgene_163704 Copy   


http://www.addgene.org/163685

Species: Mus musculus
Genetic Insert: synatophysin 9X HA tag T2A tdtomato
Vector Backbone Description: Vector Backbone:AAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33043885

Proper citation: RRID:Addgene_163685 Copy   


http://www.addgene.org/163603

Species: Mus musculus
Genetic Insert: Bmpr2
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163603 Copy   


  • RRID:Addgene_163604

http://www.addgene.org/163604

Species: Mus musculus
Genetic Insert: cofilin1
Vector Backbone Description: Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163604 Copy   


  • RRID:Addgene_163607

http://www.addgene.org/163607

Species: Mus musculus
Genetic Insert: Rac1
Vector Backbone Description: Vector Backbone:pCAFNF; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163607 Copy   


http://www.addgene.org/163621

Species: Mus musculus
Genetic Insert: mouse SNX27-H112A RNAi-resistant
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31775031
Comments: fw primer RNAi resistant rat: GGGCAGCTGGAGAACCAAGTGATCGCATTCGAATGGGATGAGATGC

Proper citation: RRID:Addgene_163621 Copy   


http://www.addgene.org/163620

Species: Mus musculus
Genetic Insert: mouse SNX27 RNAi-resistant
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31775031
Comments: fw primer RNAi resistant rat: GGGCAGCTGGAGAACCAAGTGATCGCATTCGAATGGGATGAGATGC

Proper citation: RRID:Addgene_163620 Copy   


http://www.addgene.org/163610

Species: Mus musculus
Genetic Insert: cofilin1
Vector Backbone Description: Vector Backbone:pBluescript SK(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34161760

Proper citation: RRID:Addgene_163610 Copy   


  • RRID:Addgene_163619

    This resource has 1+ mentions.

http://www.addgene.org/163619

Species: Mus musculus
Genetic Insert: mouse SNX27-H112A
Vector Backbone Description: Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31775031

Proper citation: RRID:Addgene_163619 Copy   


  • RRID:Addgene_163761

    This resource has 1+ mentions.

http://www.addgene.org/163761

Species: Mus musculus
Genetic Insert: DHFR
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pYX233; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30886345

Proper citation: RRID:Addgene_163761 Copy   


  • RRID:Addgene_16383

    This resource has 1+ mentions.

http://www.addgene.org/16383

Species: Mus musculus
Genetic Insert: PKC beta II
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12794082

Proper citation: RRID:Addgene_16383 Copy   


  • RRID:Addgene_163759

    This resource has 1+ mentions.

http://www.addgene.org/163759

Species: Mus musculus
Genetic Insert: b2-DHFR
Vector Backbone Description: Backbone Size:7400; Vector Backbone:pYX233; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30886345

Proper citation: RRID:Addgene_163759 Copy   


http://www.addgene.org/163930

Species: Mus musculus
Genetic Insert: Fusion of vhhGPF4 nanobody (intracellular) with mouse CD8 transmembrane protein and mCherry fluorophor
Vector Backbone Description: Backbone Marker:Kanca, O. et.al., Raeppli: a whole-tissue labeling tool for live imaging of Drosophila development. Development (2014); Backbone Size:8900; Vector Backbone:pUASTLOTattB; Vector Types:Insect Expression, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28395731
Comments: pUASTLOTattB vector: Kanca, O., Caussinus, E., Denes, A. S., Percival-Smith, A. & Affolter, M. Raeppli: a whole-tissue labeling tool for live imaging of Drosophila development. Development 141, 472–480 (2014). vhhGFP4 plasmid: Saerens D, Pellis M, Loris R, Pardon E, Dumoulin M, Matagne A, Wyns L, Muyldermans S, Conrath K J Mol Biol. 2005 Sep 23; 352(3):597-607. mCD8 plasmid: Lee, T. & Luo, L. Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron 22, 451–461 (1999). mCherry: Clonetech

Proper citation: RRID:Addgene_163930 Copy   


  • RRID:Addgene_163905

http://www.addgene.org/163905

Species: Mus musculus
Genetic Insert: ADAP1
Vector Backbone Description: Backbone Marker:thermo fisher (Invitrogen); Backbone Size:4807; Vector Backbone:pFastBac HTb; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:33443153

Proper citation: RRID:Addgene_163905 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X