Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 475 showing 9481 ~ 9500 out of 178,636 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_48031

http://www.addgene.org/48031

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 end linker

Proper citation: RRID:Addgene_48031 Copy   


  • RRID:Addgene_48035

http://www.addgene.org/48035

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 end linker

Proper citation: RRID:Addgene_48035 Copy   


  • RRID:Addgene_48033

http://www.addgene.org/48033

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 end linker

Proper citation: RRID:Addgene_48033 Copy   


  • RRID:Addgene_48034

http://www.addgene.org/48034

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 end linker

Proper citation: RRID:Addgene_48034 Copy   


  • RRID:Addgene_48028

http://www.addgene.org/48028

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 end linker

Proper citation: RRID:Addgene_48028 Copy   


  • RRID:Addgene_48026

http://www.addgene.org/48026

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 end linker

Proper citation: RRID:Addgene_48026 Copy   


  • RRID:Addgene_48025

http://www.addgene.org/48025

Vector Backbone Description: Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21364738
Comments: level 2 end linker

Proper citation: RRID:Addgene_48025 Copy   


  • RRID:Addgene_48138

    This resource has 1000+ mentions.

http://www.addgene.org/48138

Species: Synthetic
Genetic Insert: hSpCas9
Vector Backbone Description: Vector Backbone:PX458; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24157548
Comments: For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/.

Proper citation: RRID:Addgene_48138 Copy   


  • RRID:Addgene_48097

http://www.addgene.org/48097

Vector Backbone Description: Backbone Marker:Andreas Kaczmarczyk; Backbone Size:7535; Vector Backbone:pQF; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline
Defining Citation: PMID:23995928

Proper citation: RRID:Addgene_48097 Copy   


  • RRID:Addgene_48098

http://www.addgene.org/48098

Vector Backbone Description: Backbone Marker:Andreas Kaczmarczyk; Backbone Size:7535; Vector Backbone:pQF; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline
Defining Citation: PMID:23995928

Proper citation: RRID:Addgene_48098 Copy   


  • RRID:Addgene_48131

    This resource has 1+ mentions.

http://www.addgene.org/48131

Genetic Insert: gfp
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705

Proper citation: RRID:Addgene_48131 Copy   


http://www.addgene.org/48090

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48090 Copy   


  • RRID:Addgene_48094

http://www.addgene.org/48094

Genetic Insert: E. coli lacZ
Vector Backbone Description: Backbone Marker:Andreas Kaczmarczyk; Backbone Size:7300; Vector Backbone:pQF; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline
Defining Citation: PMID:23995928

Proper citation: RRID:Addgene_48094 Copy   


  • RRID:Addgene_48092

http://www.addgene.org/48092

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:6706; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48092 Copy   


http://www.addgene.org/48086

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48086 Copy   


http://www.addgene.org/48084

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48084 Copy   


  • RRID:Addgene_48123

http://www.addgene.org/48123

Genetic Insert: signal peptide of Pac
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20435764

Proper citation: RRID:Addgene_48123 Copy   


  • RRID:Addgene_48121

http://www.addgene.org/48121

Genetic Insert: codon optimized signal peptide of YngK
Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20435764

Proper citation: RRID:Addgene_48121 Copy   


http://www.addgene.org/48089

Species: Homo sapiens
Genetic Insert: Methyl-CpG Binding Protein 2 (Rett Syndrome)
Vector Backbone Description: Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23452848

Proper citation: RRID:Addgene_48089 Copy   


http://www.addgene.org/48238

Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org

Proper citation: RRID:Addgene_48238 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X