Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: anti-GFP nanobody VHH
Vector Backbone Description: Backbone Marker:Merck - Novagen; Vector Backbone:pET24a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:41182966
Proper citation: RRID:Addgene_243767 Copy
Genetic Insert: luxCDABE
Vector Backbone Description: Vector Backbone:pRSCqBsaI; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_236109 Copy
Species: Mus musculus
Genetic Insert: diacylglycerol lipase, beta
Vector Backbone Description: Vector Backbone:PX601-AAV-CMV::NLS-SaCas9-NLS- 3xHA-bGHpA;U6::BsaI-sgRNA; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:35715418
Proper citation: RRID:Addgene_240023 Copy
Species: Homo sapiens
Genetic Insert: eIF3c
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:41432235
Proper citation: RRID:Addgene_240026 Copy
Species: Homo sapiens
Genetic Insert: eIF3f
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:41432235
Proper citation: RRID:Addgene_240029 Copy
Species: Homo sapiens
Genetic Insert: eIF3e
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:41432235
Proper citation: RRID:Addgene_240028 Copy
Genetic Insert: 24xGCN4::T2A
Vector Backbone Description: Backbone Size:3107; Vector Backbone:pBSK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41189716
Proper citation: RRID:Addgene_246458 Copy
Species: Homo sapiens
Genetic Insert: NRF1 full length
Vector Backbone Description: Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41633991
Proper citation: RRID:Addgene_237455 Copy
Species: Homo sapiens
Genetic Insert: NRF1 ∆exon-7
Vector Backbone Description: Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41633991
Proper citation: RRID:Addgene_237454 Copy
Vector Backbone Description: Backbone Marker:Thomas Gonatopoulos-Pournatzis (Addgene plasmid # 209025); Vector Backbone:pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41633991
Comments: Guide expression cassettes contain 10x Genomics capture sequence 2 (CS2), tevopreQ1 riboswitch, and BveI cloning sites.
Proper citation: RRID:Addgene_237451 Copy
Vector Backbone Description: Backbone Marker:Thomas Gonatopoulos-Pournatzis (Addgene plasmid # 209025); Vector Backbone:pLCHKOv3; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41633991
Comments: These hgRNAs are processed by Cas13b to cleave the capped 5' end and by Cas12a to remove the polyadenylated 3' end (nucleases not encoded on this plasmid). The vector contains BveI cloning sites and includes a puromycin resistance marker for selection.
Proper citation: RRID:Addgene_237452 Copy
Species: Synthetic
Genetic Insert: NanoLuc
Vector Backbone Description: Vector Backbone:pCDNA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41335466
Proper citation: RRID:Addgene_238947 Copy
Species: Caulobacter crescentus
Genetic Insert: sgRNA
Vector Backbone Description: Vector Backbone:pBXMCS2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:40298107
Comments: sgRNA sequence: tctcttgatgagatcgacgg
Please visit https://doi.org/10.1101/2024.12.02.626314 for bioRxiv preprint.
Proper citation: RRID:Addgene_232326 Copy
Vector Backbone Description: Vector Backbone:pCS2+ Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41633991
Proper citation: RRID:Addgene_237457 Copy
Species: Homo sapiens
Genetic Insert: mRuby2-HRAS(G12V)
Vector Backbone Description: Backbone Marker:Addgene #17297; Vector Backbone:pLentiX1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40913769
Comments: Please visit https://doi.org/10.1101/2024.12.19.629350 for bioRxiv preprint.
Proper citation: RRID:Addgene_244165 Copy
Species: Aequorea victoria
Genetic Insert: mGreenLantern
Vector Backbone Description: Backbone Marker:Addgene #17297; Vector Backbone:pLentiX1; Vector Types:Lentiviral, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:41083901
Comments: Please visit https://doi.org/10.1101/2024.06.19.599813 for bioRxiv preprint.
Proper citation: RRID:Addgene_246342 Copy
Species: Agrobacterium tumefaciens
Genetic Insert: 6GAL4UAS (Dex inducible expression system) promoter
Vector Backbone Description: Backbone Size:2249; Vector Backbone:pICSL01008; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Comments: Level 0 promoter module used for GoldenGate assemblies using the MoClo overhang syntax
Proper citation: RRID:Addgene_245653 Copy
Species: Mus musculus
Genetic Insert: SNAP-p53DD
Vector Backbone Description: Vector Backbone:pMXs-gw; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:40913769
Comments: Please visit https://doi.org/10.1101/2024.12.19.629350 for bioRxiv preprint.
Proper citation: RRID:Addgene_244168 Copy
Species: Synthetic
Genetic Insert: N-Terminal tag V5
Vector Backbone Description: Backbone Size:2246; Vector Backbone:pICSL01002; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Comments: Level 0 N-Terminal tag module used for GoldenGate assemblies using the MoClo overhang syntax
Proper citation: RRID:Addgene_245535 Copy
Species: Synthetic
Genetic Insert: C-Terminal tag 3xGly4Ser-GAL4
Vector Backbone Description: Backbone Size:2244; Vector Backbone:pICSL01003; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Comments: Level 0 C-Terminal tag module used for GoldenGate assemblies using the MoClo overhang syntax
Proper citation: RRID:Addgene_245620 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
