Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 475 showing 9481 ~ 9500 out of 33,936 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_160099

http://www.addgene.org/160099

Species: Mus musculus
Genetic Insert: Mavs
Vector Backbone Description: Vector Backbone:pENTR1A backbone; Vector Types:Mammalian Expression, Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32371478

Proper citation: RRID:Addgene_160099 Copy   


  • RRID:Addgene_160015

http://www.addgene.org/160015

Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5016; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125031 and 125064); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787

Proper citation: RRID:Addgene_160015 Copy   


http://www.addgene.org/160136

Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443

Proper citation: RRID:Addgene_160136 Copy   


  • RRID:Addgene_160016

http://www.addgene.org/160016

Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5146; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125031 and 125064); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787

Proper citation: RRID:Addgene_160016 Copy   


http://www.addgene.org/160137

Species: Synthetic
Genetic Insert: SpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443

Proper citation: RRID:Addgene_160137 Copy   


http://www.addgene.org/160138

Species: Synthetic
Genetic Insert: AsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
Vector Backbone Description: Vector Backbone:DR274 (Addgene plasmid #42250); Vector Types:in vitro transcription of sgRNA from T7 promoter; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33547443

Proper citation: RRID:Addgene_160138 Copy   


  • RRID:Addgene_160018

http://www.addgene.org/160018

Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5427; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125031 and 125064); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787

Proper citation: RRID:Addgene_160018 Copy   


  • RRID:Addgene_160263

http://www.addgene.org/160263

Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754

Proper citation: RRID:Addgene_160263 Copy   


  • RRID:Addgene_160176

http://www.addgene.org/160176

Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5640; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125032 and 125065); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787

Proper citation: RRID:Addgene_160176 Copy   


  • RRID:Addgene_160178

http://www.addgene.org/160178

Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754

Proper citation: RRID:Addgene_160178 Copy   


  • RRID:Addgene_160179

http://www.addgene.org/160179

Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754

Proper citation: RRID:Addgene_160179 Copy   


  • RRID:Addgene_160215

http://www.addgene.org/160215

Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5129; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125033 and 125066); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787

Proper citation: RRID:Addgene_160215 Copy   


  • RRID:Addgene_160207

http://www.addgene.org/160207

Vector Backbone Description: Backbone Marker:Partially Addgene; Backbone Size:5336; Vector Backbone:Constructed from MoClo Yeast Toolkit (Kit # 1000000061) and own yeast homology arms (Addgene plasmids 125032 and 125065); Vector Types:Yeast Expression, Kluyveromyces marxianus; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33176787

Proper citation: RRID:Addgene_160207 Copy   


  • RRID:Addgene_160230

http://www.addgene.org/160230

Vector Backbone Description: Backbone Marker:Dianne Duncan; Backbone Size:1961; Vector Backbone:pXZ13lacZalpha; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin
Comments: Modification of pXZ13lacZalpha construct to exchange Kanamycin gene for original Ampicillin gene. This improves upon the cloning efficiency of the original pXZ13 vector (reference below) in three ways: 1) The distance between the Esp3I sites is increased to increase cutting efficiency, 2) lacZalpha complementation is introduced to allow for blue/white screening of recombinants, and 3) Kanamycin selection removes 3 of the 4 original parental plasmids from forming colonies in the final plating. Original vector reference: Zhang X, Koolhaas WH, Schnorrer F. A Versatile Two-Step CRISPR- and RMCE-Based Strategy for Efficient Genome Engineering in Drosophila. G3 (Bethesda). 2014 Oct 15;4(12):2409-18

Proper citation: RRID:Addgene_160230 Copy   


  • RRID:Addgene_160185

http://www.addgene.org/160185

Vector Backbone Description: Vector Backbone:pRSF; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32955754

Proper citation: RRID:Addgene_160185 Copy   


  • RRID:Addgene_160399

http://www.addgene.org/160399

Species: Synthetic
Genetic Insert: 35S::vitis GRF4-GIF1 chimera
Vector Backbone Description: Backbone Size:17356; Vector Backbone:pGWB14; Vector Types:Binary vector; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33046875

Proper citation: RRID:Addgene_160399 Copy   


  • RRID:Addgene_160433

    This resource has 1+ mentions.

http://www.addgene.org/160433

Species: Escherichia coli
Genetic Insert: E. coli AlkB
Vector Backbone Description: Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33337498

Proper citation: RRID:Addgene_160433 Copy   


  • RRID:Addgene_160434

http://www.addgene.org/160434

Species: Escherichia coli
Genetic Insert: E. coli AlkB
Vector Backbone Description: Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33337498

Proper citation: RRID:Addgene_160434 Copy   


http://www.addgene.org/160436

Species: Homo sapiens
Genetic Insert: Homo sapiens amyloid beta precursor protein
Vector Backbone Description: Vector Backbone:pUCIDT; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:33659494

Proper citation: RRID:Addgene_160436 Copy   


  • RRID:Addgene_160317

http://www.addgene.org/160317

Species: Homo sapiens
Genetic Insert: COL4A1
Vector Backbone Description: Backbone Marker:Clonetech; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:32554938
Comments: Please note: Plasmid contains a T824P mutation in the insert (lies within the Mature Domain). This variant is not known to affect plasmid function.

Proper citation: RRID:Addgene_160317 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X