Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Authority:addgene (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

178,636 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pICH83977
 
Resource Report
Resource Website 		RRID:Addgene_48031 Ampicillin PMID:21364738 level 2 end linker Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-09-01 09:55:50 0
pICH84011
 
Resource Report
Resource Website 		RRID:Addgene_48035 Ampicillin PMID:21364738 level 2 end linker Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-09-01 09:55:50 0
pICH83999
 
Resource Report
Resource Website 		RRID:Addgene_48033 Ampicillin PMID:21364738 level 2 end linker Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-09-01 09:55:50 0
pICH84000
 
Resource Report
Resource Website 		RRID:Addgene_48034 Ampicillin PMID:21364738 level 2 end linker Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-09-01 09:55:50 0
pICH49300
 
Resource Report
Resource Website 		RRID:Addgene_48028 Ampicillin PMID:21364738 level 2 end linker Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-09-01 09:55:50 0
pICH49283
 
Resource Report
Resource Website 		RRID:Addgene_48026 Ampicillin PMID:21364738 level 2 end linker Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-09-01 09:55:50 0
pICH49277
 
Resource Report
Resource Website 		RRID:Addgene_48025 Ampicillin PMID:21364738 level 2 end linker Backbone Marker:self-made; Backbone Size:4349; Vector Backbone:derived from pBIN19 and pUC19; Vector Types:Unspecified; Bacterial Resistance:Ampicillin 2026-09-01 09:55:50 0
pSpCas9(BB)-2A-GFP (PX458)
 
Resource Report
Resource Website
1000+ mentions 		RRID:Addgene_48138 hSpCas9 Synthetic Ampicillin PMID:24157548 For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/. Vector Backbone:PX458; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 09:55:52 2375
pQM
 
Resource Report
Resource Website 		RRID:Addgene_48097 Tetracycline PMID:23995928 Backbone Marker:Andreas Kaczmarczyk; Backbone Size:7535; Vector Backbone:pQF; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline 2026-09-01 09:55:51 0
pQY
 
Resource Report
Resource Website 		RRID:Addgene_48098 Tetracycline PMID:23995928 Backbone Marker:Andreas Kaczmarczyk; Backbone Size:7535; Vector Backbone:pQF; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline 2026-09-01 09:55:51 0
pPK1E-1+t-gfp
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48131 gfp Ampicillin PMID:20596705 Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 09:55:52 1
pGEX-5x3-hMeCP2-delN256-G273X
 
Resource Report
Resource Website 		RRID:Addgene_48090 Methyl-CpG Binding Protein 2 (Rett Syndrome) Homo sapiens Ampicillin PMID:23452848 Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted the N-terminal 256 codons, expresses AT-Hook G273X 2026-09-01 09:55:51 0
pQF-lacZ
 
Resource Report
Resource Website 		RRID:Addgene_48094 E. coli lacZ Tetracycline PMID:23995928 Backbone Marker:Andreas Kaczmarczyk; Backbone Size:7300; Vector Backbone:pQF; Vector Types:Bacterial Expression; Bacterial Resistance:Tetracycline 2026-09-01 09:55:51 0
pTXB1-hMeCP2-R270X
 
Resource Report
Resource Website 		RRID:Addgene_48092 Methyl-CpG Binding Protein 2 (Rett Syndrome) Homo sapiens Ampicillin PMID:23452848 Backbone Size:6706; Vector Backbone:pTXB1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Mxe intein/chitin binding domain tagged, expresses AT-Hook R270X 2026-09-01 09:55:51 0
pCMX-Gal4-hMeCP2-R270X-R111G
 
Resource Report
Resource Website 		RRID:Addgene_48086 Methyl-CpG Binding Protein 2 (Rett Syndrome) Homo sapiens Ampicillin PMID:23452848 Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin R111G mutant MeCP2, expresses AT-hook R270X 2026-09-01 09:55:51 0
pCMX-Gal4-hMeCP2-G273X
 
Resource Report
Resource Website 		RRID:Addgene_48084 Methyl-CpG Binding Protein 2 (Rett Syndrome) Homo sapiens Ampicillin PMID:23452848 Backbone Size:4500; Vector Backbone:pCMX-Gal4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin expresses AT-Hook G273X 2026-09-01 09:55:51 0
pSPPac-hp
 
Resource Report
Resource Website 		RRID:Addgene_48123 signal peptide of Pac Ampicillin PMID:20435764 Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 09:55:52 0
pSPYngK+-hp
 
Resource Report
Resource Website 		RRID:Addgene_48121 codon optimized signal peptide of YngK Ampicillin PMID:20435764 Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin 2026-09-01 09:55:52 0
pGEX-5x3-hMeCP2-delN256-R270X
 
Resource Report
Resource Website 		RRID:Addgene_48089 Methyl-CpG Binding Protein 2 (Rett Syndrome) Homo sapiens Ampicillin PMID:23452848 Backbone Size:4974; Vector Backbone:pGEX-5x3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin deleted the N-terminal 256 codons, expresses AT-Hook R270X 2026-09-01 09:55:51 0
pAC152-dual-dCas9VP64-sgExpression
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_48238 dCas9 Synthetic Ampicillin PMID:23979020 Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT For more information including protocols and updates, please go to http://www.crispr-on.org Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin D10A;H840A 2026-09-01 09:55:53 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch