Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:8626; Vector Backbone:RRL.PPT.SFFV.RFP657.IRES2.PAC.PRE; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24952903
Proper citation: RRID:Addgene_61395 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pHT-01; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61325 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61329 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61328 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61327 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pHT-43; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61326 Copy
Genetic Insert: Green fluorescent protein
Vector Backbone Description: Vector Backbone:pRBI-DsbC; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25386923
Proper citation: RRID:Addgene_61320 Copy
Species: E. coli
Genetic Insert: SCRIBE_kanR(ON)
Vector Backbone Description: Backbone Marker:Expressys; Vector Backbone:pZE32; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:25395541
Proper citation: RRID:Addgene_61450 Copy
Species: Homo sapiens
Genetic Insert: CenpB-GFP-Halo
Vector Backbone Description: Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25400104
Proper citation: RRID:Addgene_61502 Copy
Species: Oryza sativa
Genetic Insert: OsMIR390-B/c
Vector Backbone Description: Backbone Size:11592; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:25809382
Proper citation: RRID:Addgene_61465 Copy
Species: Oryza sativa
Genetic Insert: OsMIR390-B/c
Vector Backbone Description: Backbone Size:9620; Vector Backbone:pMDC123; Vector Types:Plant Expression; Bacterial Resistance:Chloramphenicol and Kanamycin
Defining Citation: PMID:25809382
Proper citation: RRID:Addgene_61466 Copy
Species: Homo sapiens
Genetic Insert: HaloTag-GFP-Mito
Vector Backbone Description: Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25400104
Proper citation: RRID:Addgene_61500 Copy
Species: Homo sapiens
Genetic Insert: HaloTag-GFP-PACT
Vector Backbone Description: Backbone Marker:Dr. Eugene Makeyev; Vector Backbone:pEM791; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25400104
Proper citation: RRID:Addgene_61501 Copy
Genetic Insert: AMPK Biosensor
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25892241
Comments: Mitochondrial targeting signal (DAKAP1-30): ATGGCAATCCAGTTGCGTTCGCTCTTCCCCTTGGCGTTGCCCGGAATGCTGGCCCTCCTTGGCTGGTGGTGGTTTTTCTCTCGTAAAAAA
Proper citation: RRID:Addgene_61509 Copy
Species: Homo sapiens
Genetic Insert: PK-hLC3∆G
Vector Backbone Description: Backbone Size:9000; Vector Backbone:FUGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25340751
Comments: We thank Dr. James Edward Rothman for providing respective pHluorin.
Proper citation: RRID:Addgene_61461 Copy
Genetic Insert: EGFP
Vector Backbone Description: Backbone Size:4159; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24618276
Proper citation: RRID:Addgene_61462 Copy
Species: Mus musculus
Genetic Insert: gccgctcccggatctcctgc
Vector Backbone Description: Vector Backbone:px335; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25569111
Proper citation: RRID:Addgene_61514 Copy
Species: Mus musculus
Genetic Insert: Mettl3
Vector Backbone Description: Vector Backbone:pBRPy; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25569111
Proper citation: RRID:Addgene_61516 Copy
Species: Arabidopsis thaliana
Genetic Insert: U6-26:sgRNA
Vector Backbone Description: Backbone Marker:GeneArt; Backbone Size:2400; Vector Backbone:pMA-T; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836556
Proper citation: RRID:Addgene_61476 Copy
Species: Arabidopsis thaliana
Genetic Insert: Cas9-D10A
Vector Backbone Description: Backbone Size:7100; Vector Backbone:pPZP221; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:24836556
Proper citation: RRID:Addgene_61477 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
