Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Proper citation: RRID:Addgene_48233 Copy
Species: Cylindrospermum licheniforme
Genetic Insert: CylA
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23106426
Proper citation: RRID:Addgene_48198 Copy
Species: Homo sapiens
Genetic Insert: Ataxin1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657
Proper citation: RRID:Addgene_48192 Copy
Species: Homo sapiens
Genetic Insert: Ataxin1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657
Proper citation: RRID:Addgene_48193 Copy
Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-puro
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48226 Copy
Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48227 Copy
Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP96 activation domain
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48224 Copy
Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48225 Copy
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR4; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48228 Copy
Species: Mus musculus
Genetic Insert: Capicua
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3783; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657
Proper citation: RRID:Addgene_48185 Copy
Species: Homo sapiens
Genetic Insert: Ataxin1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657
Proper citation: RRID:Addgene_48189 Copy
Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP64 activation domain
Vector Backbone Description: Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48223 Copy
Species: Mus musculus
Genetic Insert: Capicua
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:3783; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23512657
Proper citation: RRID:Addgene_48188 Copy
Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A) fusion with VP160 activation domain
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48221 Copy
Species: M. jannaschii
Genetic Insert: polyspecific MJ tyrosyl synthetase
Vector Backbone Description: Backbone Marker:Schultz lab; Vector Backbone:pULTRA; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:17061854
Comments: This plasmid was also used in Chatterjee et al Biochemistry. 2013 Feb 27. PMID: 23379331
Proper citation: RRID:Addgene_48215 Copy
Species: Homo sapiens
Genetic Insert: dCas9(D10A;H840A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23979020
Comments: For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48218 Copy
Species: Homo sapiens
Genetic Insert: 5" UTR of MC2R
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376
Proper citation: RRID:Addgene_48174 Copy
Species: Homo sapiens
Genetic Insert: TAS2R3 taste 2 receptor member 3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376
Proper citation: RRID:Addgene_48175 Copy
Vector Backbone Description: Backbone Size:4729; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a MYFQSNA fusion tag on the N-terminus
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA.
Proper citation: RRID:Addgene_48293 Copy
Species: Homo sapiens
Genetic Insert: 5" UTR of MC2R
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376
Proper citation: RRID:Addgene_48173 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
