Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: STIM1
Vector Backbone Description: Backbone Marker:See author's map; Backbone Size:6000; Vector Backbone:MO91; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16921383
Comments: See Author's Map for empty backbone (MO91) information.
Proper citation: RRID:Addgene_19754 Copy
Species: Homo sapiens
Genetic Insert: Orai1
Vector Backbone Description: Backbone Size:0; Vector Backbone:EGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16921383
Proper citation: RRID:Addgene_19757 Copy
Species: Homo sapiens
Genetic Insert: cyclin-dependent kinase 8
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900
Proper citation: RRID:Addgene_19758 Copy
Species: Homo sapiens
Genetic Insert: small hairpin RNA against beta-catenin
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18794900
Comments: 2279 refers to the shRNA
clone name from the RNAi Consortium at the Broad Institute and indicates the
location on the CTNNB1 mRNA that is targeted.
shRNA sequence for 2279 is:
CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAGTCTCATTCCAAGCTTTTT
Proper citation: RRID:Addgene_19762 Copy
Species: Mus musculus
Genetic Insert: Klf4
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.
Proper citation: RRID:Addgene_19764 Copy
Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.
Proper citation: RRID:Addgene_19763 Copy
Species: Mus musculus
Genetic Insert: Oct4
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.
Note that the region immediately upstream of the insert in the author's sequence is not 100% accurate. See Addgene's quality control sequence for this region.
Proper citation: RRID:Addgene_19766 Copy
Species: Mus musculus
Genetic Insert: Sox2
Vector Backbone Description: Backbone Size:9941; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371448
Comments: From article: A tet-inducible lentivirus called LV-tetO was generated by removing the EcoRI/PacI fragment containing the ubiquitin promoter elements from the FUdeltaGW vector (modified from FUGW by removal of GFP with EcoRI-XbaI and re-creation of the EcoRI site) and replacing it with tetO sequences derived from pTet-Splice by EcoRI/XhoI digestion.cDNAs for c-Myc (T58A mutant), Klf4, Oct4, and Sox2 were isolated from pMIG or pMX vectors and cloned into LV-tetO using a unique EcoRI restriction site.
Proper citation: RRID:Addgene_19765 Copy
Species: Mus musculus
Genetic Insert: RASSF1A
Vector Backbone Description: Backbone Size:4657; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11857081
Proper citation: RRID:Addgene_1980 Copy
Species: Mus musculus
Genetic Insert: oligo targeting p53 and PTEN
Vector Backbone Description: Backbone Size:7994; Vector Backbone:MSCV FLIPi; Vector Types:Mammalian Expression, Retroviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18779577
Comments: Constitutively expresses puromycin-resistance and GFP. Recombines to express surface Thy1.1 and miR30-based RNAi. The miRNA is contained within an artificial intron, and splicing of the intron can boost transgene expression (1.5 to 2-fold). The expression of surface Thy1.1 facilitates antibody-mediated cell sorting.
See FLIP vector protocols (PDF from this page) for more information.
There are minor discrepancies between the depositor's sequence and Addgene's sequencing results. The mismatches are either coding joints or a sequencing difference between the actual and the published miR30 vector sequence.
Proper citation: RRID:Addgene_19746 Copy
Species: Mus musculus
Genetic Insert: oligo targeting p53
Vector Backbone Description: Backbone Size:7994; Vector Backbone:MSCV FLIPi; Vector Types:Mammalian Expression, Retroviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18779577
Comments: Constitutively expresses puromycin-resistance and GFP. Recombines to express surface Thy1.1 and miR30-based RNAi. The miRNA is contained within an artificial intron, and splicing of the intron can boost transgene expression (1.5 to 2-fold). The expression of surface Thy1.1 facilitates antibody-mediated cell sorting.
See FLIP vector protocols (PDF from this page) for more information.
There are minor discrepancies between the depositor's sequence and Addgene's sequencing results. The mismatches are either coding joints or a sequencing difference between the actual and the published miR30 vector sequence.
Proper citation: RRID:Addgene_19748 Copy
Species: Homo sapiens
Genetic Insert: TRF2
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:5300; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:9476899
Proper citation: RRID:Addgene_19798 Copy
Species: Homo sapiens
Genetic Insert: Fragment of p53-Binding Protein 1
Vector Backbone Description: Backbone Marker:Scott Lowe; Backbone Size:5600; Vector Backbone:pLPC; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18931659
Proper citation: RRID:Addgene_19835 Copy
Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:S Rees et al., BioTechniques 1996; Backbone Size:5257; Vector Backbone:pcin4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19838 Copy
Species: Homo sapiens
Genetic Insert: MKL1
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pRev TRE; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19846 Copy
Species: Homo sapiens
Genetic Insert: MKL1-N100
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6500; Vector Backbone:pRev TRE; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18694962
Comments: The 3xFlag in the vector is from Sigma, p3xFlag-CMV-7.1 has variant flag sequences (DYKDHD) and is recognized well by their anti-flag monoclonal M2.
Proper citation: RRID:Addgene_19848 Copy
Species: Homo sapiens
Genetic Insert: c-myc
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19775 Copy
Species: Homo sapiens
Genetic Insert: Klf4
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19777 Copy
Species: Homo sapiens
Genetic Insert: NanogP8
Vector Backbone Description: Backbone Size:8400; Vector Backbone:FUdeltaGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18786420
Comments: From article, concerning viral infections: For a standard infection in a 35 mmdish (aprox 10^5 cells), 10 microL rtTA+5 microL factors (OCT4, SOX2, KLF4, and NANOG)+2 microL cMYC was used in an overnight infection supplemented with 6 microg/microL polybrene.
Proper citation: RRID:Addgene_19776 Copy
Genetic Insert: Firefly Luciferase
Vector Backbone Description: Backbone Size:8072; Vector Backbone:p156RRL-sinPPT-CMV-GFP-PRE/Nhe I; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19657394
Proper citation: RRID:Addgene_19785 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
