Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
IpO Resource Report Resource Website 1+ mentions |
RRID:Addgene_48233 | URA3 3' fragment | Saccharomyces cerevisiae | Ampicillin | PMID:24604451 | Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin | URA3 ORF from +216 to 80 bp downstream of the stop codon | 2026-09-01 09:55:53 | 1 | |
|
pET-28a-CylA Resource Report Resource Website |
RRID:Addgene_48198 | CylA | Cylindrospermum licheniforme | Kanamycin | PMID:23106426 | Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-09-01 09:55:53 | 0 | ||
|
Flag-ATXN1_S602D_L686E Resource Report Resource Website |
RRID:Addgene_48192 | Ataxin1 | Homo sapiens | Ampicillin | PMID:23512657 | Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:53 | 0 | ||
|
Flag-ATXN1_L588A Resource Report Resource Website |
RRID:Addgene_48193 | Ataxin1 | Homo sapiens | Ampicillin | PMID:23512657 | Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:53 | 0 | ||
|
pAC94-pmax-dCas9VP160-2A-puro Resource Report Resource Website 1+ mentions |
RRID:Addgene_48226 | dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-puro | Homo sapiens | Kanamycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | D10A;H840A (catalytically inactive) | 2026-09-01 09:55:53 | 9 |
|
pAC95-pmax-dCas9VP160-2A-neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_48227 | dCas9(D10A;H840A) fusion with VP160 activation domain followed by 2A-neo | Homo sapiens | Kanamycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | D10A;H840A (catalytically inactive) | 2026-09-01 09:55:53 | 8 |
|
pAC92-pmax-dCas9VP96 Resource Report Resource Website |
RRID:Addgene_48224 | dCas9(D10A;H840A) fusion with VP96 activation domain | Homo sapiens | Kanamycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | D10A;H840A | 2026-09-01 09:55:53 | 0 |
|
pAC93-pmax-dCas9VP160 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48225 | dCas9(D10A;H840A) fusion with VP160 activation domain | Homo sapiens | Kanamycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | D10A;H840A (catalytically inactive) | 2026-09-01 09:55:53 | 6 |
|
pAC103-PBNeo-U6-sgRNA-Expression Resource Report Resource Website |
RRID:Addgene_48228 | Ampicillin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Backbone Marker:Invitrogen; Vector Backbone:pCR4; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:53 | 0 | |||
|
Myc-CICf Resource Report Resource Website 1+ mentions |
RRID:Addgene_48185 | Capicua | Mus musculus | Ampicillin | PMID:23512657 | Backbone Marker:Clontech; Backbone Size:3783; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:52 | 2 | ||
|
Flag-ATXN1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48189 | Ataxin1 | Homo sapiens | Ampicillin | PMID:23512657 | Backbone Marker:Invitrogen; Backbone Size:4767; Vector Backbone:pcDNA1.1/Amp; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:53 | 3 | ||
|
pAC91-pmax-dCas9VP64 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48223 | dCas9(D10A;H840A) fusion with VP64 activation domain | Homo sapiens | Kanamycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Vector Backbone:pmax-DEST (Addgene: 48222); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Kanamycin | D10A;H840A (catalytically inactive) | 2026-09-01 09:55:53 | 2 |
|
Myc-CICf_AEA Resource Report Resource Website |
RRID:Addgene_48188 | Capicua | Mus musculus | Ampicillin | PMID:23512657 | Backbone Marker:Clontech; Backbone Size:3783; Vector Backbone:pCMV-Myc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:53 | 0 | ||
|
pAC149-pCR8-dCas9VP160 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48221 | dCas9(D10A;H840A) fusion with VP160 activation domain | Homo sapiens | Spectinomycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin | D10A;H840A nuclease-deficient | 2026-09-01 09:55:53 | 1 |
|
pULTRA-CNF Resource Report Resource Website 10+ mentions |
RRID:Addgene_48215 | polyspecific MJ tyrosyl synthetase | M. jannaschii | Spectinomycin | PMID:17061854 | This plasmid was also used in Chatterjee et al Biochemistry. 2013 Feb 27. PMID: 23379331 | Backbone Marker:Schultz lab; Vector Backbone:pULTRA; Vector Types:Bacterial Expression; Bacterial Resistance:Spectinomycin | Y32L, L65V, F108W, Q109M, D158G, I159A | 2026-09-01 09:55:53 | 15 |
|
pAC84-pCR8-dCas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_48218 | dCas9(D10A;H840A) | Homo sapiens | Spectinomycin | PMID:23979020 | For more information including protocols and updates, please go to http://www.crispr-on.org | Backbone Marker:Invitrogen; Backbone Size:2799; Vector Backbone:pCR8/GW/TOPO; Vector Types:CRISPR, Gateway Cloning; Bacterial Resistance:Spectinomycin | D10A;H840A | 2026-09-01 09:55:53 | 2 |
|
psicheck-2-Mc2r Resource Report Resource Website |
RRID:Addgene_48174 | 5" UTR of MC2R | Homo sapiens | Ampicillin | PMID:19372376 | Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:52 | 0 | ||
|
psicheck-2-Tas2r3-mod Resource Report Resource Website |
RRID:Addgene_48175 | TAS2R3 taste 2 receptor member 3 | Homo sapiens | Ampicillin | PMID:19372376 | Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | T/C MUTATION IN ATG OF UORF | 2026-09-01 09:55:52 | 0 | |
|
pET MYFQSNA tagged cloning vector with BioBrick polycistronic restriction sites (9U) Resource Report Resource Website |
RRID:Addgene_48293 | Ampicillin | This plasmid is an empty vector to be used with a LIC cloning protocol. It has a MYFQSNA fusion tag on the N-terminus To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify.When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/ Note: The plasmid as it is provided enocdes "MYFQSNI". However, the vector is supposed to be cut with SspI (AATATT), which is a blunt cutter that cuts between the N and the "I" (this ends up not being transcribed, however). Then, provided you use the LIC tags on your PCR primers that we've suggested, the forward primer will introduce an A residue immediately downstream of the N. The final tag, therefore, is MYFQSNA. | Backbone Size:4729; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:55:54 | 0 | ||||
|
psicheck-2-Mc2r-mod Resource Report Resource Website |
RRID:Addgene_48173 | 5" UTR of MC2R | Homo sapiens | Ampicillin | PMID:19372376 | Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | A/G MUTATION IN ATG OF UORF | 2026-09-01 09:55:52 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
