Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Sox1
Vector Backbone Description: Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25454632
Proper citation: RRID:Addgene_61545 Copy
Species: Mus musculus
Genetic Insert: mCry1
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25228643
Proper citation: RRID:Addgene_61429 Copy
Species: Homo sapiens
Genetic Insert: NOTCH-ICD
Vector Backbone Description: Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25454632
Proper citation: RRID:Addgene_61540 Copy
Species: Mus musculus
Genetic Insert: Pax6
Vector Backbone Description: Backbone Size:8376; Vector Backbone:TetO-FUW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25454632
Proper citation: RRID:Addgene_61541 Copy
Species: Synthetic
Genetic Insert: F2620-rbs33-hrpR-ter
Vector Backbone Description: Backbone Marker:BioBrick registry; Backbone Size:2750; Vector Backbone:pSB3K3; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22009040
Proper citation: RRID:Addgene_61436 Copy
Species: Synthetic
Genetic Insert: hrpL-rbs30-gfp-ter
Vector Backbone Description: Backbone Marker:BioBrick registry; Backbone Size:3547; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22009040
Proper citation: RRID:Addgene_61437 Copy
Species: Synthetic
Genetic Insert: HrpL-rbs32-CI-LVA-t-plam-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick registry; Backbone Size:3547; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22009040
Proper citation: RRID:Addgene_61438 Copy
Species: Synthetic
Genetic Insert: HrpL-rbs34-CI-LVA-t-plam-30gfp-t
Vector Backbone Description: Backbone Marker:BioBrick registry; Backbone Size:3547; Vector Backbone:pSB4A3; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22009040
Proper citation: RRID:Addgene_61439 Copy
Species: Arabidopsis thaliana
Genetic Insert: AtU6-26:sgRNA
Vector Backbone Description: Backbone Marker:Promega Corp.; Backbone Size:3000; Vector Backbone:pGEM-T-easy; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24836556
Proper citation: RRID:Addgene_61432 Copy
Species: Arabidopsis thaliana
Genetic Insert: Cas9
Vector Backbone Description: Backbone Size:7100; Vector Backbone:pPZP221; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:24836556
Proper citation: RRID:Addgene_61433 Copy
Species: Mus musculus
Genetic Insert: mPER2
Vector Backbone Description: Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25228643
Proper citation: RRID:Addgene_61430 Copy
Species: Other
Genetic Insert: LovTAP N538E
Vector Backbone Description: Vector Backbone:pCAL-N; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20562867
Proper citation: RRID:Addgene_61431 Copy
Species: E. coli
Genetic Insert: Beta recombinase
Vector Backbone Description: Backbone Marker:Expressys; Vector Backbone:pZA11; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25395541
Proper citation: RRID:Addgene_61446 Copy
Species: Mus musculus
Genetic Insert: MyoD
Vector Backbone Description: Backbone Size:12000; Vector Backbone:pRRL; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25953198
Proper citation: RRID:Addgene_61441 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G beta 2 miR-shRNA
G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Proper citation: RRID:Addgene_25759 Copy
Species: Homo sapiens
Genetic Insert: PIK3CA
Vector Backbone Description: Backbone Size:6775; Vector Backbone:pLP-LNCX (Clontech); Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17060456
Proper citation: RRID:Addgene_25634 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4218; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter + DsRed2 spacer; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25755 Copy
Species: Homo sapiens
Genetic Insert: p53-shRNA-941
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17060456
Proper citation: RRID:Addgene_25637 Copy
Species: Homo sapiens
Genetic Insert: p53-shRNA-427
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17060456
Proper citation: RRID:Addgene_25636 Copy
Species: Mus musculus
Genetic Insert: G alpha 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with U6-driven G alpha 12 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
Addgene sequence shows that this plasmid is missing the EcoRI site.
Proper citation: RRID:Addgene_25757 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.