Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 477 showing 9521 ~ 9540 out of 178,636 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_48179

http://www.addgene.org/48179

Species: Mus musculus
Genetic Insert: 5" UTR of HSDL2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376

Proper citation: RRID:Addgene_48179 Copy   


  • RRID:Addgene_48170

http://www.addgene.org/48170

Species: Homo sapiens
Genetic Insert: 5" UTR of SFXN3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376

Proper citation: RRID:Addgene_48170 Copy   


http://www.addgene.org/48290

Vector Backbone Description: Backbone Size:4774; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable StrepII fusion tag on the N-terminusTo clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48290 Copy   


  • RRID:Addgene_48203

http://www.addgene.org/48203

Species: Opsanus tau
Genetic Insert: Twitch-2B
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24390440
Comments: Insert contains: BamHI-NotI-ECFP-SphI-TnC-SacI-YCP-EcoRI There is a discrepancy in the publication, Plasmid 48203: Twitch-2B pRSETB and Plasmid 49531: Twitch-2B pcDNA3 are misidentified.

Proper citation: RRID:Addgene_48203 Copy   


  • RRID:Addgene_48163

http://www.addgene.org/48163

Species: Mus musculus
Genetic Insert: 5" UTR of Phb
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376

Proper citation: RRID:Addgene_48163 Copy   


http://www.addgene.org/48161

Species: Mus musculus
Genetic Insert: 5" UTR of Slc25a15
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:3500; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376

Proper citation: RRID:Addgene_48161 Copy   


http://www.addgene.org/48283

Vector Backbone Description: Backbone Size:4710; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. To clone into this vector, add LIC version 2 fusion tags to the 5' end of your PCR primers. Forward - 5'TTTAAGAAGGAGATATAGATC3' Reverse - 5'TTATGGAGTTGGGATCTTATTA3'In addition, ensure that your open reading frame contains an ATG start codon. Linearize the plasmid with EcoRV and gel purify. When digesting the DNA with T4 polymerase for LIC version 2, use dGTP for insert and dCTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48283 Copy   


  • RRID:Addgene_48200

http://www.addgene.org/48200

Species: Cylindrospermum licheniforme
Genetic Insert: CylI
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5293; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23106426

Proper citation: RRID:Addgene_48200 Copy   


http://www.addgene.org/48288

Vector Backbone Description: Backbone Size:4762; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable FLAG fusion tag on the N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48288 Copy   


  • RRID:Addgene_48201

    This resource has 10+ mentions.

http://www.addgene.org/48201

Species: Aequorea victoria green
Genetic Insert: eGFP
Vector Backbone Description: Backbone Marker:Gage lab (Addgene plasmid# 16664); Backbone Size:6764; Vector Backbone:CAG-GFP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16399667

Proper citation: RRID:Addgene_48201 Copy   


http://www.addgene.org/48289

Vector Backbone Description: Backbone Size:5134; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-Mocr fusion tag on the N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48289 Copy   


  • RRID:Addgene_48165

http://www.addgene.org/48165

Species: Mus musculus
Genetic Insert: 5" UTR of Mut
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376

Proper citation: RRID:Addgene_48165 Copy   


http://www.addgene.org/48287

Vector Backbone Description: Backbone Size:5497; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV cleavable His6-msfGFP fusion tag on the N-terminus. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48287 Copy   


  • RRID:Addgene_48158

http://www.addgene.org/48158

Species: Mus musculus
Genetic Insert: 5" UTR of Acsm2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6273; Vector Backbone:psicheck2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19372376

Proper citation: RRID:Addgene_48158 Copy   


http://www.addgene.org/48157

Species: P. pyralis
Genetic Insert: luciferase
Vector Backbone Description: Backbone Marker:Courtney Boehlke; Backbone Size:7000; Vector Backbone:pLew90β-T7-GW-Neo; Vector Types:Luciferase, T. cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616

Proper citation: RRID:Addgene_48157 Copy   


  • RRID:Addgene_48149

http://www.addgene.org/48149

Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705

Proper citation: RRID:Addgene_48149 Copy   


  • RRID:Addgene_48262

http://www.addgene.org/48262

Species: Saccharomyces cerevisiae
Genetic Insert: TEF1p 5' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: Created by 4-part ligation with XhoI/EagI cut pBluescript II SK (-). Inserts were XhoI/XbaI TEF1p, XbaI/BamHI URA3, and BamHI/EagI TEF1p.

Proper citation: RRID:Addgene_48262 Copy   


  • RRID:Addgene_48145

http://www.addgene.org/48145

Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705

Proper citation: RRID:Addgene_48145 Copy   


  • RRID:Addgene_48146

http://www.addgene.org/48146

Vector Backbone Description: Backbone Marker:Malten et al., 2005; Vector Backbone:pMM1520; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705

Proper citation: RRID:Addgene_48146 Copy   


  • RRID:Addgene_48143

    This resource has 1+ mentions.

http://www.addgene.org/48143

Genetic Insert: rna polymerase SP6
Vector Backbone Description: Backbone Marker:Gamer et al., 2009; Vector Backbone:pMGBm19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Comments: Please note that the V313A mutation in RNAP was present in the original sample and functions as described in the publication.

Proper citation: RRID:Addgene_48143 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X