Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCAG-RFP-miR-Scrint
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19825 Scrambled miRNA Ampicillin PMID:18840295 miR-Scr sequence: GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin 2026-09-01 09:35:36 4
pDESTmycQKI
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19870 quaking homolog, KH domain RNA binding Homo sapiens Ampicillin PMID:18978028 Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:44 1
pDESTmycEIF2C2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19872 Eukaryotic translation initiation factor 2C, 2 Homo sapiens Ampicillin PMID:18978028 Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:44 1
pDESTmycPABPC4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19877 PABPC4 Homo sapiens Ampicillin PMID:18978028 Please note that the full PABPC4 sequence may differ from the depositor's sequence. Please see pFRT/TO/FLAG/HA-DEST PABPC4 (Plasmid #19882) for reference. Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:45 1
pDESTmycIGF2BP3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19879 Insulin-like growth factor 2 mRNA binding protein 3 Homo sapiens Ampicillin PMID:18978028 Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:46 5
pFRT/FLAG/HA-DEST EIF2C4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19890 Eukaryotic translation initiation factor 2C, 4 Homo sapiens Ampicillin PMID:18978028 Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:47 1
pFRT/TO/FLAG/HA-DEST PABPC4
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19882 Poly(A) binding protein, cytoplasmic 4 Homo sapiens Ampicillin PMID:18978028 Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:46 1
pFRT/TO/FLAG/HA-DEST TNRC6C
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19885 Trinucleotide repeat containing 6C Homo sapiens Ampicillin PMID:18978028 Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:47 1
pFRT/TO/FLAG/HA-DEST TNRC6B
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19884 trinucleotide repeat containing 6B Homo sapiens Ampicillin PMID:18978028 Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:47 1
pFRT/FLAG/HA-DEST EIF2C1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19887 Eukaryotic translation initiation factor 2C, 1 Homo sapiens Ampicillin PMID:18978028 Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:47 1
pFRT/FLAG/HA-DEST EIF2C2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19888 Eukaryotic translation initiation factor 2C, 2 Homo sapiens Ampicillin PMID:18978028 Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:47 6
pCMV-Cyclin D1
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_19927 Cyclin D1 Homo sapiens Ampicillin PMID:9465025 Backbone Size:5500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:54 11
pCMV-L26-Flag
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19972 Rpl26 Homo sapiens Ampicillin PMID:18951086 Made by Yaara Ofir-Rosenfeld Backbone Size:5270; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:36:01 1
PCTAIRE-1-DN-HA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_1998 PCTAIRE-1 Homo sapiens Ampicillin PMID:8266103 See scanned map. Backbone Size:6550; Vector Backbone:pCMV-neo-Bam; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Dominant negative, D304N in conserved KLAD*FGLAR stretch 2026-09-01 09:36:03 1
psiCHECK IRF9 3'UTR
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19863 IRF9 3'UTR Homo sapiens Ampicillin PMID:18978028 There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct. Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:43 1
pCDNA3-myc3-FBW5
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19905 F-box and WD repeat domain containing 5 Homo sapiens Ampicillin PMID:18381890 Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3-myc3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:50 1
pcDNA3-myc3-CUL4A
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_19951 CUL4A (cullin 4A) Homo sapiens Ampicillin PMID:12504025 The CUL4A insert in this plasmid contains a K644R substitution when compared to GenBank reference sequence NM_001008895. Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:58 15
pcDNA3-HA-CUL1 delta N53
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19950 cullin 1 delta N53 Homo sapiens Ampicillin PMID:12504025 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deletion of 53 residues from the NH2-terminus(delta N53) 2026-09-01 09:35:58 1
pcDNA3-myc3-CUL4A delta N100
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19953 CUL4A (cullin 4A) Homo sapiens Ampicillin PMID:12504025 Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin The longest published clone (Q13619) 2026-09-01 09:35:58 1
pcDNA3-myc3-14-3-3 Beta
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_19957 14-3-3 Protein Beta Homo sapiens Ampicillin PMID:12468542 Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3-myc3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 09:35:59 2

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch