Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 477 showing 9521 ~ 9540 out of 32,424 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_19825

    This resource has 1+ mentions.

http://www.addgene.org/19825

Genetic Insert: Scrambled miRNA
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: miR-Scr sequence: GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC

Proper citation: RRID:Addgene_19825 Copy   


  • RRID:Addgene_19870

    This resource has 1+ mentions.

http://www.addgene.org/19870

Species: Homo sapiens
Genetic Insert: quaking homolog, KH domain RNA binding
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19870 Copy   


  • RRID:Addgene_19872

    This resource has 1+ mentions.

http://www.addgene.org/19872

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 2
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19872 Copy   


  • RRID:Addgene_19877

    This resource has 1+ mentions.

http://www.addgene.org/19877

Species: Homo sapiens
Genetic Insert: PABPC4
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: Please note that the full PABPC4 sequence may differ from the depositor's sequence. Please see pFRT/TO/FLAG/HA-DEST PABPC4 (Plasmid #19882) for reference.

Proper citation: RRID:Addgene_19877 Copy   


  • RRID:Addgene_19879

    This resource has 1+ mentions.

http://www.addgene.org/19879

Species: Homo sapiens
Genetic Insert: Insulin-like growth factor 2 mRNA binding protein 3
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19879 Copy   


  • RRID:Addgene_19890

    This resource has 1+ mentions.

http://www.addgene.org/19890

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19890 Copy   


  • RRID:Addgene_19882

    This resource has 1+ mentions.

http://www.addgene.org/19882

Species: Homo sapiens
Genetic Insert: Poly(A) binding protein, cytoplasmic 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19882 Copy   


  • RRID:Addgene_19885

    This resource has 1+ mentions.

http://www.addgene.org/19885

Species: Homo sapiens
Genetic Insert: Trinucleotide repeat containing 6C
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19885 Copy   


  • RRID:Addgene_19884

    This resource has 1+ mentions.

http://www.addgene.org/19884

Species: Homo sapiens
Genetic Insert: trinucleotide repeat containing 6B
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19884 Copy   


  • RRID:Addgene_19887

    This resource has 1+ mentions.

http://www.addgene.org/19887

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 1
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19887 Copy   


  • RRID:Addgene_19888

    This resource has 1+ mentions.

http://www.addgene.org/19888

Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 2
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028

Proper citation: RRID:Addgene_19888 Copy   


  • RRID:Addgene_19927

    This resource has 10+ mentions.

http://www.addgene.org/19927

Species: Homo sapiens
Genetic Insert: Cyclin D1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9465025

Proper citation: RRID:Addgene_19927 Copy   


  • RRID:Addgene_19972

    This resource has 1+ mentions.

http://www.addgene.org/19972

Species: Homo sapiens
Genetic Insert: Rpl26
Vector Backbone Description: Backbone Size:5270; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18951086
Comments: Made by Yaara Ofir-Rosenfeld

Proper citation: RRID:Addgene_19972 Copy   


  • RRID:Addgene_1998

    This resource has 1+ mentions.

http://www.addgene.org/1998

Species: Homo sapiens
Genetic Insert: PCTAIRE-1
Vector Backbone Description: Backbone Size:6550; Vector Backbone:pCMV-neo-Bam; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8266103
Comments: See scanned map.

Proper citation: RRID:Addgene_1998 Copy   


  • RRID:Addgene_19863

    This resource has 1+ mentions.

http://www.addgene.org/19863

Species: Homo sapiens
Genetic Insert: IRF9 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.

Proper citation: RRID:Addgene_19863 Copy   


  • RRID:Addgene_19905

    This resource has 1+ mentions.

http://www.addgene.org/19905

Species: Homo sapiens
Genetic Insert: F-box and WD repeat domain containing 5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3-myc3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18381890

Proper citation: RRID:Addgene_19905 Copy   


  • RRID:Addgene_19951

    This resource has 10+ mentions.

http://www.addgene.org/19951

Species: Homo sapiens
Genetic Insert: CUL4A (cullin 4A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12504025
Comments: The CUL4A insert in this plasmid contains a K644R substitution when compared to GenBank reference sequence NM_001008895.

Proper citation: RRID:Addgene_19951 Copy   


  • RRID:Addgene_19950

    This resource has 1+ mentions.

http://www.addgene.org/19950

Species: Homo sapiens
Genetic Insert: cullin 1 delta N53
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12504025

Proper citation: RRID:Addgene_19950 Copy   


  • RRID:Addgene_19953

    This resource has 1+ mentions.

http://www.addgene.org/19953

Species: Homo sapiens
Genetic Insert: CUL4A (cullin 4A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12504025

Proper citation: RRID:Addgene_19953 Copy   


  • RRID:Addgene_19957

    This resource has 1+ mentions.

http://www.addgene.org/19957

Species: Homo sapiens
Genetic Insert: 14-3-3 Protein Beta
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3-myc3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12468542

Proper citation: RRID:Addgene_19957 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X