Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: Scrambled miRNA
Vector Backbone Description: Backbone Size:6300; Vector Backbone:pCAG-RFP-int; Vector Types:Mammalian Expression, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18840295
Comments: miR-Scr sequence:
GGTACCTGCTGTTGACAGTGAGCGACGATGCTCTAATCGGTTCTATCAAGTGAAGCCACAGATGTTGATAGAACCTTAGAGCATCGCTGCCTACTGCCTCGGACTTCAAGGGGAATTC
Proper citation: RRID:Addgene_19825 Copy
Species: Homo sapiens
Genetic Insert: quaking homolog, KH domain RNA binding
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19870 Copy
Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 2
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19872 Copy
Species: Homo sapiens
Genetic Insert: PABPC4
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: Please note that the full PABPC4 sequence may differ from the depositor's sequence. Please see pFRT/TO/FLAG/HA-DEST PABPC4 (Plasmid #19882) for reference.
Proper citation: RRID:Addgene_19877 Copy
Species: Homo sapiens
Genetic Insert: Insulin-like growth factor 2 mRNA binding protein 3
Vector Backbone Description: Backbone Size:5862; Vector Backbone:pDESTmyc; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19879 Copy
Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19890 Copy
Species: Homo sapiens
Genetic Insert: Poly(A) binding protein, cytoplasmic 4
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19882 Copy
Species: Homo sapiens
Genetic Insert: Trinucleotide repeat containing 6C
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19885 Copy
Species: Homo sapiens
Genetic Insert: trinucleotide repeat containing 6B
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19884 Copy
Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 1
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19887 Copy
Species: Homo sapiens
Genetic Insert: Eukaryotic translation initiation factor 2C, 2
Vector Backbone Description: Backbone Size:5421; Vector Backbone:pFRT/TO/FLAG/HA-DEST; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Proper citation: RRID:Addgene_19888 Copy
Species: Homo sapiens
Genetic Insert: Cyclin D1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9465025
Proper citation: RRID:Addgene_19927 Copy
Species: Homo sapiens
Genetic Insert: Rpl26
Vector Backbone Description: Backbone Size:5270; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18951086
Comments: Made by Yaara Ofir-Rosenfeld
Proper citation: RRID:Addgene_19972 Copy
Species: Homo sapiens
Genetic Insert: PCTAIRE-1
Vector Backbone Description: Backbone Size:6550; Vector Backbone:pCMV-neo-Bam; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8266103
Comments: See scanned map.
Proper citation: RRID:Addgene_1998 Copy
Species: Homo sapiens
Genetic Insert: IRF9 3'UTR
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6249; Vector Backbone:psiCHECK-2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18978028
Comments: There are small differences between author's sequence and Addgene sequence. Depositor is aware of the changes. These changes in the sequence do not affect the function of the construct.
Proper citation: RRID:Addgene_19863 Copy
Species: Homo sapiens
Genetic Insert: F-box and WD repeat domain containing 5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3-myc3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18381890
Proper citation: RRID:Addgene_19905 Copy
Species: Homo sapiens
Genetic Insert: CUL4A (cullin 4A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12504025
Comments: The CUL4A insert in this plasmid contains a K644R substitution when compared to GenBank reference sequence NM_001008895.
Proper citation: RRID:Addgene_19951 Copy
Species: Homo sapiens
Genetic Insert: cullin 1 delta N53
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12504025
Proper citation: RRID:Addgene_19950 Copy
Species: Homo sapiens
Genetic Insert: CUL4A (cullin 4A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12504025
Proper citation: RRID:Addgene_19953 Copy
Species: Homo sapiens
Genetic Insert: 14-3-3 Protein Beta
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5437; Vector Backbone:pcDNA3-myc3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12468542
Proper citation: RRID:Addgene_19957 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
