Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT
Proper citation: RRID:Addgene_25752 Copy
Species: Mus musculus
Genetic Insert: Nampt
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:16783373
Proper citation: RRID:Addgene_25630 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE
Proper citation: RRID:Addgene_25751 Copy
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven GFP
Proper citation: RRID:Addgene_25767 Copy
Genetic Insert: 0
Vector Backbone Description: Backbone Size:5020; Vector Backbone:pAAV (Strategene); Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18784188
Comments: Please note that an 11bp deletion was found in the 3' ITR ("AAV2 alternate). The depositing lab was not able to confirm whether this was present in their original stock.
Proper citation: RRID:Addgene_25648 Copy
Vector Backbone Description: Backbone Marker:N/A; Backbone Size:8673; Vector Backbone:pMAK700, pMAK705, pBS-TS; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:9335267
Comments: pKOV is identical to the pKO3 vector described in J. Bacteriology 179: 6228-6237, except for the addition of a 3kb stuffer sequence in the multiple cloning site. This stuffer permits (i) directional cloning using NotI and BamHI and (ii) clean separation of doubly cut vector from singly cut contaminants when using this pair of enzymes. The pKOV cloning site is: 5' - SmaI - NotI - SmaI- stuffer - BamHI - SalI - 3'. BamHI and SalI are not used together, nor is SmaI used with NotI. BglII & BclI cut ends are compatible with BamHI. PmeI & SwaI are compatible with SmaI.
NOTE: pKOV has a temperature sensitive pSC101 replication origin. To recover the plasmid, strains harboring the plasmid must be grown at 30 deg C under chloramphenicol selection.
Gene replacement: Mutant alleles cloned into the pKOV gene replacement vector are electroporated into recombination proficient strains (eg. EMG2) and allowed to recover for 1 h at 30 deg C. The cells are plated on prewarmed chloramphenicol/LB plates and incubated at 42 deg C. To measure the integration frequency, the electroporated cells are also plated on chloramphenicol/LB plates at 30 deg C. From the 42 deg C plate, 1-5 colonies are picked into 1 ml of LB broth, serially diluted, and immediately plated at 30°ree;C on either 5% w/v sucrose or 5% sucrose+antibiotic plates. The 5% sucrose plates are replica plated to chloramphenicol plates at 30 deg C to test for loss of the replacement vector (cms). The gene replacement is confirmed by either PCR using primers flanking the targeted open reading frame or by genomic Southern's.
Note from depositor: If sucrose plates do not select correctly, pKOV should be used in liquid selection on a plate reader with a LB + Cm control growth and a LB + Cm + sucrose growth. pKOV can sometimes still allow survival in the presence of sucrose, but significantly decreases fitness, so tracking the kinetic growth can be helpful.
The sacB gene loses its efficacy,, sacB is toxic in E. coli even in the absence of sucrose.
Proper citation: RRID:Addgene_25769 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 and 12 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA
G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function.
Proper citation: RRID:Addgene_25763 Copy
Species: Mus musculus
Genetic Insert: G alpha 13 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G alpha 13 miR-shRNA
G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25762 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25765 Copy
Species: Homo sapiens
Genetic Insert: Protein tyrosine phosphatase receptor-type delta
Vector Backbone Description: Backbone Marker:System Biosciences; Backbone Size:6606; Vector Backbone:pCDF1-MCS2-EF1-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19074898
Proper citation: RRID:Addgene_25643 Copy
Species: Mus musculus
Genetic Insert: Gb2 miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA
Addgene sequence shows that this plasmid is missing the SpeI site.
Proper citation: RRID:Addgene_25764 Copy
Species: Homo sapiens
Genetic Insert: RB1-shRNA 19
Vector Backbone Description: Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20354191
Proper citation: RRID:Addgene_25640 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:16945906
Comments: Entry vector with TRE-driven luciferase miR-shRNA
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25760 Copy
Species: Homo sapiens
Genetic Insert: UEV1
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 2A4D http://www.thesgc.org/structures/2A4D/
Proper citation: RRID:Addgene_25619 Copy
Species: Homo sapiens
Genetic Insert: UBE2H
Vector Backbone Description: Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: PDB: 1YH6 http://www.thesgc.org/structures/1YH6/
Proper citation: RRID:Addgene_25618 Copy
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16945906
Comments: pSLIK-Venus with TRE-driven Luciferase
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25739 Copy
Genetic Insert: None
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:13170; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16945906
Comments: Parent lentivector, co-expression of Venus selection gene
Proper citation: RRID:Addgene_25734 Copy
Vector Backbone Description: Backbone Marker:Iain Fraser; Backbone Size:12944; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:16945906
Comments: Parent lentivector, co-expression of Zeocin selection gene
Proper citation: RRID:Addgene_25736 Copy
Species: Homo sapiens
Genetic Insert: IRS1
Vector Backbone Description: Backbone Marker:Oligoengine; Backbone Size:6349; Vector Backbone:pSUPERIOR RETRO-PURO; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19843521
Comments: sense 5′-GAT CCC GCT ATG CTG ACA TGT GAA TAC TTC CTG TCA TGT TCG CAT GTC AGC ATA GCT TTT TA-3′
Proper citation: RRID:Addgene_25698 Copy
Species: Homo sapiens
Genetic Insert: XIAP
Vector Backbone Description: Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:14701799
Comments: #1202
Proper citation: RRID:Addgene_25693 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
