Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: rna polymerase K1E
Vector Backbone Description: Backbone Marker:Gamer et al., 2009; Vector Backbone:pMGBm19; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20596705
Proper citation: RRID:Addgene_48144 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: URA3 3' fragment
Vector Backbone Description: Backbone Marker:Agilent Technologies; Backbone Size:2961; Vector Backbone:pBluescript II SK (-); Vector Types:Routine cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24604451
Comments: pJH124 was created by cloning an XbaI/XhoI Ag TEF1 promoter fragment into the same sites of vector IpO. The cloned insert was confirmed by DNA sequencing.
Proper citation: RRID:Addgene_48259 Copy
Vector Backbone Description: Vector Backbone:pRT100/pPZP312; Vector Types:Binary Gateway vector; Bacterial Resistance:Chloramphenicol and Spectinomycin
Defining Citation: PMID:19366901
Proper citation: RRID:Addgene_48258 Copy
Species: Synthetic
Genetic Insert: HYPER-RED-C199S
Vector Backbone Description: Backbone Size:3975; Vector Backbone:pC1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25330925
Proper citation: RRID:Addgene_48252 Copy
Species: Synthetic
Genetic Insert: dCas9
Vector Backbone Description: Vector Backbone:pX335 (Addgene #42335); Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23979020
Comments: Clone sgRNA spacer into BbsI site. Sequence using LKO5' primer: GACTATCATATGCTTACCGT
For more information including protocols and
updates, please go to http://www.crispr-on.org
Proper citation: RRID:Addgene_48240 Copy
Species: Escherichia coli CFT073
Genetic Insert: ClbP
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5370; Vector Backbone:pET29b-(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23406518
Proper citation: RRID:Addgene_48244 Copy
Species: Escherichia coli CFT073
Genetic Insert: ClbP-pep
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5370; Vector Backbone:pET29b-(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23406518
Proper citation: RRID:Addgene_48243 Copy
Species: T. brucei
Genetic Insert: Partial beta-TUB followed by 5' ALD UTR-loxP-SAS-BLE-Ty1-TK-loxP-3' ALD UTR
Vector Backbone Description: Backbone Marker:Cross Lab; Vector Backbone:pHD309; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html
There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab; most notably in the beta-tubulin ORF, HSV thymidine kinase and the T. brucei Aldolase 3'UTR. These mismatches should not affect plasmid function.
Proper citation: RRID:Addgene_48359 Copy
Species: Synthetic
Genetic Insert: EYFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48350 Copy
Species: Synthetic
Genetic Insert: ECFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2651; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48353 Copy
Species: Synthetic
Genetic Insert: EGFP
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2655; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48348 Copy
Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2639; Vector Backbone:pDONRP2R-P3; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48345 Copy
Species: Synthetic
Genetic Insert: V5 and 6xHis epitope tags cassette
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2645; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48346 Copy
Species: Synthetic
Genetic Insert: mKate2
Vector Backbone Description: Backbone Marker:Life Technologies/Invitrogen; Backbone Size:2646; Vector Backbone:pDONRP4-P1R; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23957834
Proper citation: RRID:Addgene_48344 Copy
Species: Photinus pyralis
Genetic Insert: firely luciferase
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29578409
Proper citation: RRID:Addgene_48336 Copy
Species: Photinus pyralis
Genetic Insert: firely luciferase
Vector Backbone Description: Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20644616
Proper citation: RRID:Addgene_48337 Copy
Species: Mus musculus
Genetic Insert: 5-hydroxytriptamine receptor isoform 6
Vector Backbone Description: Backbone Size:5300; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24056873
Proper citation: RRID:Addgene_48339 Copy
Vector Backbone Description: Backbone Size:9643; Vector Backbone:pRS422; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.
This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Ade auxotrophy.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).
For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48299 Copy
Genetic Insert: TVA receptor mCherry
Vector Backbone Description: Backbone Size:6000; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24239125
Proper citation: RRID:Addgene_48332 Copy
Vector Backbone Description: Backbone Size:6148; Vector Backbone:pFastBac; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28668116
Comments: This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector has a TEV cleavable StrepII-msfGFP tag on the N-terminus.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
Series 11 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. For more information, please see our website: https://macrolab.qb3.berkeley.edu/dna-cloning/
Proper citation: RRID:Addgene_48297 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
