Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pEN_TTmiRc2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25752 | Gentamicin | PMID:16945906 | shRNA expression; miR30-based topology; TRE-TIGHT Pmin promoter; Entry vector backbone; +ccdB in parent; Spe1 d/s of TRE-TIGHT | Backbone Marker:ATCC 10326362; Backbone Size:4422; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:52 | 6 | |||
|
Nampt-PET28a Resource Report Resource Website 1+ mentions |
RRID:Addgene_25630 | Nampt | Mus musculus | Kanamycin | PMID:16783373 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:PET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:02:47 | 1 | ||
|
pEN_Tmcs Resource Report Resource Website 1+ mentions |
RRID:Addgene_25751 | Gentamicin | PMID:16945906 | TRE Pmin promoter; Entry vector backbone; +ccdB in parent; Multiple cloning sites d/s of TRE | Backbone Marker:ATCC 10326362; Backbone Size:4347; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:52 | 6 | |||
|
pEN_TRE_GFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_25767 | Gentamicin | PMID:16945906 | Entry vector with TRE-driven GFP | Backbone Marker:ATCC 10326362; Backbone Size:4655; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:53 | 1 | |||
|
pAAV-SEPT-Acceptor Resource Report Resource Website 1+ mentions |
RRID:Addgene_25648 | 0 | Ampicillin | PMID:18784188 | Please note that an 11bp deletion was found in the 3' ITR ("AAV2 alternate). The depositing lab was not able to confirm whether this was present in their original stock. | Backbone Size:5020; Vector Backbone:pAAV (Strategene); Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:52 | 3 | ||
|
pKOV Resource Report Resource Website 10+ mentions |
RRID:Addgene_25769 | Chloramphenicol | PMID:9335267 | pKOV is identical to the pKO3 vector described in J. Bacteriology 179: 6228-6237, except for the addition of a 3kb stuffer sequence in the multiple cloning site. This stuffer permits (i) directional cloning using NotI and BamHI and (ii) clean separation of doubly cut vector from singly cut contaminants when using this pair of enzymes. The pKOV cloning site is: 5' - SmaI - NotI - SmaI- stuffer - BamHI - SalI - 3'. BamHI and SalI are not used together, nor is SmaI used with NotI. BglII & BclI cut ends are compatible with BamHI. PmeI & SwaI are compatible with SmaI. NOTE: pKOV has a temperature sensitive pSC101 replication origin. To recover the plasmid, strains harboring the plasmid must be grown at 30 deg C under chloramphenicol selection. Gene replacement: Mutant alleles cloned into the pKOV gene replacement vector are electroporated into recombination proficient strains (eg. EMG2) and allowed to recover for 1 h at 30 deg C. The cells are plated on prewarmed chloramphenicol/LB plates and incubated at 42 deg C. To measure the integration frequency, the electroporated cells are also plated on chloramphenicol/LB plates at 30 deg C. From the 42 deg C plate, 1-5 colonies are picked into 1 ml of LB broth, serially diluted, and immediately plated at 30°ree;C on either 5% w/v sucrose or 5% sucrose+antibiotic plates. The 5% sucrose plates are replica plated to chloramphenicol plates at 30 deg C to test for loss of the replacement vector (cms). The gene replacement is confirmed by either PCR using primers flanking the targeted open reading frame or by genomic Southern's. Note from depositor: If sucrose plates do not select correctly, pKOV should be used in liquid selection on a plate reader with a LB + Cm control growth and a LB + Cm + sucrose growth. pKOV can sometimes still allow survival in the presence of sucrose, but significantly decreases fitness, so tracking the kinetic growth can be helpful. The sacB gene loses its efficacy,, sacB is toxic in E. coli even in the absence of sucrose. | Backbone Marker:N/A; Backbone Size:8673; Vector Backbone:pMAK700, pMAK705, pBS-TS; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2026-08-29 01:02:53 | 10 | |||
|
pEN_TmiR_G13-L_G12-E Resource Report Resource Website |
RRID:Addgene_25763 | G alpha 13 and 12 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G alpha 12 and 13 miR-shRNA G alpha 12 miR-shRNA: GCGACACCATCTTCGACAACAT G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT There are 3 minor changes between depositor's sequence and Addgene's sequence - An extra T between the TRE promoter and first shRNA; a 17nt stretch between the shRNAs is different but will not affect function; and a single nt change mutates an EcoRI site just beyond the 2nd shRNA but will again not affect function. | Backbone Marker:ATCC 10326362; Backbone Size:4641; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:52 | 0 | |
|
pEN_TmiR_G13-L Resource Report Resource Website |
RRID:Addgene_25762 | G alpha 13 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G alpha 13 miR-shRNA G alpha 13 miR-shRNA: CTGGGTGAGTCTGTAAAGTATT Addgene sequence shows that this plasmid is missing the SpeI site. | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:52 | 0 | |
|
pEN_TGmiR_Luc-A Resource Report Resource Website |
RRID:Addgene_25765 | Luciferase miR-shRNA | Gentamicin | PMID:16945906 | Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT | Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:53 | 0 | ||
|
pCDF1-PTPRD-G446E Resource Report Resource Website |
RRID:Addgene_25643 | Protein tyrosine phosphatase receptor-type delta | Homo sapiens | Ampicillin | PMID:19074898 | Backbone Marker:System Biosciences; Backbone Size:6606; Vector Backbone:pCDF1-MCS2-EF1-Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | tumor-derived mutation created by site-directed mutagenesis: nucleotide G1479A, amino acid G446E (annotated according to Ensembl transcript ENST00000381196) | 2026-08-29 01:02:51 | 0 | |
|
pEN_TmiR_Gb2-K Resource Report Resource Website |
RRID:Addgene_25764 | Gb2 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with TRE-driven G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Addgene sequence shows that this plasmid is missing the SpeI site. | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:52 | 0 | |
|
pLKO-RB1-shRNA19 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25640 | RB1-shRNA 19 | Homo sapiens | Ampicillin | PMID:20354191 | Backbone Size:7032; Vector Backbone:pLKO.1 puro; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:49 | 9 | ||
|
pEN_TmiR_Luc-A Resource Report Resource Website |
RRID:Addgene_25760 | Luciferase miR-shRNA | Gentamicin | PMID:16945906 | Entry vector with TRE-driven luciferase miR-shRNA Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT | Backbone Marker:ATCC 10326362; Backbone Size:4259; Vector Backbone:pENTR1A-Gent; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin | 2026-08-29 01:02:52 | 0 | ||
|
UEV1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25619 | UEV1 | Homo sapiens | Kanamycin | PDB: 2A4D http://www.thesgc.org/structures/2A4D/ | Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:02:41 | 3 | ||
|
UBE2H Resource Report Resource Website |
RRID:Addgene_25618 | UBE2H | Homo sapiens | Kanamycin | PDB: 1YH6 http://www.thesgc.org/structures/1YH6/ | Backbone Marker:SGC; Backbone Size:7328; Vector Backbone:pET28a-LIC; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Contains amino acid residues 1-179 | 2026-08-29 01:02:41 | 0 | |
|
pSLIK-Venus-TmiR-Luc Resource Report Resource Website |
RRID:Addgene_25739 | Luciferase miR-shRNA | Ampicillin | PMID:16945906 | pSLIK-Venus with TRE-driven Luciferase Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT | Backbone Marker:Iain Fraser; Backbone Size:12370; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:52 | 0 | ||
|
pSLIK-Venus Resource Report Resource Website 10+ mentions |
RRID:Addgene_25734 | None | Chloramphenicol and Ampicillin | PMID:16945906 | Parent lentivector, co-expression of Venus selection gene | Backbone Marker:Iain Fraser; Backbone Size:13170; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 01:02:52 | 10 | ||
|
pSLIK-Zeo Resource Report Resource Website 1+ mentions |
RRID:Addgene_25736 | Chloramphenicol and Ampicillin | PMID:16945906 | Parent lentivector, co-expression of Zeocin selection gene | Backbone Marker:Iain Fraser; Backbone Size:12944; Vector Backbone:pSLIK; Vector Types:Mammalian Expression, Lentiviral, RNAi; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-29 01:02:52 | 3 | |||
|
IRS1-B1 Resource Report Resource Website |
RRID:Addgene_25698 | IRS1 | Homo sapiens | Ampicillin | PMID:19843521 | sense 5′-GAT CCC GCT ATG CTG ACA TGT GAA TAC TTC CTG TCA TGT TCG CAT GTC AGC ATA GCT TTT TA-3′ | Backbone Marker:Oligoengine; Backbone Size:6349; Vector Backbone:pSUPERIOR RETRO-PURO; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:52 | 0 | |
|
pEBB HA XIAP H467A Resource Report Resource Website |
RRID:Addgene_25693 | XIAP | Homo sapiens | Ampicillin | PMID:14701799 | #1202 | Backbone Marker:Baltimore Lab; Backbone Size:5353; Vector Backbone:pEBB; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | H467A | 2026-08-29 01:02:52 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
