Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMXs-EGFP-Rheb SSVM-IP Resource Report Resource Website |
RRID:Addgene_13832 | Rheb SSVM | Mus musculus | Ampicillin | PMID:16046393 | Backbone Size:6900; Vector Backbone:pMX-EGFP-gw-IP; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | C181 changed to serine | 2026-09-01 09:19:34 | 0 | |
|
pCbeta EV (PKA catalytic subunit Cbeta) Resource Report Resource Website |
RRID:Addgene_15311 | PRKACB | Mus musculus | Ampicillin | PMID:3667630 | Zem3 is a pUC13 derivative that contains a mouse metallothionein-I promoter and the human growth hormone pol(A) region separated by a BglII restriction site. pCbeta EV was constructed by isolating the 1246bp SacI fragment of pMCbeta and inserting it into the BglII site of Zem3 after ligation of BamHI linkers onto the cDNA fragment. | Backbone Marker:Dr. Richard Palmiter; Backbone Size:4100; Vector Backbone:Zem3 (pUC13 + MT prom + hGH polyA); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:34 | 0 | |
|
CD3-2A_pMI-LO Resource Report Resource Website |
RRID:Addgene_153418 | murine CD3 delta-gamma-epsilon-zeta subunits | Mus musculus | Ampicillin | PMID:32328071 | Second gene is LSSmOrange | Backbone Marker:Maki Nakayama; Vector Backbone:pMI-LO; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:39 | 0 | |
|
MBC2-PuroIII Resource Report Resource Website |
RRID:Addgene_153420 | murine TCR-alpha signal peptide and murine TCR-beta2 constant region (TRBC2) | Mus musculus | Ampicillin | PMID:34611019 | Second gene is puromycin-resistant gene | Backbone Marker:Maki Nakayama; Vector Backbone:pMI-Puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:40 | 0 | |
|
pAAV-E29-ChR2GFP2x Resource Report Resource Website |
RRID:Addgene_153437 | Chr2-GFP-P2A-GFP | Mus musculus | Ampicillin | PMID:32807948 | Please visit https://www.biorxiv.org/content/10.1101/808170v1 for BioRxiv preprint. | Vector Backbone:AAV-Dlx-GFP; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:40 | 0 | |
|
pAAV-E11-ChR2GFP2x Resource Report Resource Website |
RRID:Addgene_153434 | Chr2-GFP-P2A-GFP | Mus musculus | Ampicillin | PMID:32807948 | Please visit https://www.biorxiv.org/content/10.1101/808170v1 for BioRxiv preprint. | Vector Backbone:AAV-Dlx-GFP; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:40 | 0 | |
|
pHes7-Achilles-Hes7 Resource Report Resource Website |
RRID:Addgene_153528 | Hes7 | Mus musculus | Ampicillin | PMID:31915376 | Backbone Size:2974; Vector Backbone:pBluescript; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:41 | 0 | ||
|
pQsupR-Mi2b Resource Report Resource Website 1+ mentions |
RRID:Addgene_15379 | short hairpin RNA against mouse Mi-2 beta | Mus musculus | Ampicillin | PMID:16452502 | Target sequence: GACTACGACCTGTTCAAGCAG | Backbone Marker:Smale Lab; Backbone Size:8290; Vector Backbone:pQsupR; Vector Types:Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:46 | 1 | |
|
pRVGP-BB Resource Report Resource Website 1+ mentions |
RRID:Addgene_15380 | mU6-BRG/BRM shRNA | Mus musculus | Ampicillin | PMID:16452502 | Mouse U6 promoter followed by short hairpin RNA against mouse BRG/BRM genes. Target sequence: TGGAGAAGCAGCAGAAGATT. | Backbone Marker:Smale lab; Backbone Size:8017; Vector Backbone:pRVGP; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:47 | 1 | |
|
pEsg1-6K-Luc Resource Report Resource Website |
RRID:Addgene_15394 | Upstream region of mouse Esg1 gene | Mus musculus | Ampicillin | PMID:16504174 | Backbone Size:5000; Vector Backbone:pGV-BM2; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:49 | 0 | ||
|
pPB CAG Otx2-IRES-EGFP Resource Report Resource Website |
RRID:Addgene_153947 | Otx2 | Mus musculus | Ampicillin | PMID:31996670 | Backbone Size:7061; Vector Backbone:PiggyBac transposon; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:49 | 0 | ||
|
GST-MED9 Resource Report Resource Website |
RRID:Addgene_15408 | MED9 | Mus musculus | Kanamycin | PMID:14638676 | Backbone Marker:EMD Biosciences; Backbone Size:5900; Vector Backbone:pET41a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | N/A | 2026-09-01 09:23:52 | 0 | |
|
AAV-GFAP-NLS-CasRx-NLS-FLAG-U6-DR-SgRNA_Ptbp1-DR Resource Report Resource Website 1+ mentions |
RRID:Addgene_154001 | CasRx, Ptbp1 sgRNAs | Mus musculus | Ampicillin | PMID:32272060 | INSERT 1: CasRx driven by GFAP promoter. INSERT 2: DR-SgRNA_Ptbp1 driven by U6 promoter. Ptbp1 gRNA 5: 5′-tgtagatgggctgtccacgaagcactggcg-3′ Ptbp1 gRNA 6: 5′-gcttggagaagtcgatgcgcagcgtgcagc-3′ | Vector Backbone:pAAV; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:50 | 4 | |
|
scFv-GCN4-DNMT3a-DNMT3l Resource Report Resource Website |
RRID:Addgene_154140 | scFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP | Mus musculus | Ampicillin | PMID:31941101 | Backbone Size:2663; Vector Backbone:AmpR-Ori; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:53 | 0 | ||
|
scFv-GCN4-DNMT3a(R887E)-DNMT3l Resource Report Resource Website 1+ mentions |
RRID:Addgene_154141 | scFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP | Mus musculus | Ampicillin | PMID:31941101 | Backbone Size:2663; Vector Backbone:AmpR-Ori; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | R887E | 2026-09-01 09:23:53 | 1 | |
|
FLAG-MED11 Resource Report Resource Website |
RRID:Addgene_15418 | MED11 | Mus musculus | Ampicillin | PMID:12584197 | Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | 2026-09-01 09:23:54 | 0 | |
|
pET28a-MED11 Resource Report Resource Website |
RRID:Addgene_15414 | MED11 | Mus musculus | Kanamycin | PMID:14576168 | Backbone Marker:EMD Biosciences; Backbone Size:5400; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | N/A | 2026-09-01 09:23:53 | 0 | |
|
FLAG-MED6 Resource Report Resource Website |
RRID:Addgene_15411 | MED6 | Mus musculus | Ampicillin | PMID:14576168 | Backbone Marker:Invitrogen, modified at Conaway lab; Backbone Size:5600; Vector Backbone:pcDNA3.1 N-FLAG/Hyg; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N/A | 2026-09-01 09:23:53 | 0 | |
|
pEF1α-mouse-full-length-CHMP3-HA Resource Report Resource Website |
RRID:Addgene_154176 | CHMP3 | Mus musculus | Ampicillin | PMID:34597582 | Backbone Marker:#11154; Backbone Size:4311; Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:54 | 0 | ||
|
pQCi-mB2m-sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_154090 | sgRNA targeting murine B2M locus | Mus musculus | Ampicillin | PMID:33616439 | Please visit https://www.biorxiv.org/content/10.1101/2020.03.25.008276v4 for bioRxiv preprint. | Backbone Marker:Derived from pX458 (Zhang lab); Backbone Size:9500; Vector Backbone:pQCi; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-09-01 09:23:52 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
