Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: KIBRA
Vector Backbone Description: Backbone Size:5100; Vector Backbone:pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22614006
Proper citation: RRID:Addgene_40887 Copy
Species: Homo sapiens
Genetic Insert: EPLIN alpha
Vector Backbone Description: Vector Backbone:pCMV5-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11950948
Proper citation: RRID:Addgene_40928 Copy
Species: Homo sapiens
Genetic Insert: ATBF1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20720010
Comments: Addgene NGS results found S80A, V785A variants compared to the NCBI reference [NM_006885.4].
Proper citation: RRID:Addgene_40927 Copy
Species: Homo sapiens
Genetic Insert: ATBF1
Vector Backbone Description: Backbone Marker:Kaiming Xu (Emory University); Backbone Size:6750; Vector Backbone:pKXUa1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20720010
Proper citation: RRID:Addgene_40926 Copy
Species: Homo sapiens
Genetic Insert: Smac(1-60)mCherry
Vector Backbone Description: Backbone Size:5523; Vector Backbone:pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20493813
Proper citation: RRID:Addgene_40880 Copy
Vector Backbone Description: Backbone Size:5729; Vector Backbone:pBAD; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: This plasmid is an empty vector. Your gene can be inserted via LIC cloning.
8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.
8HR adds a TEV-cleavable His6 and a strep tag to the N terminus of your protein. The dual affinity tags can help to purify difficult proteins.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Visit http://qb3.berkeley.edu/qb3/macrolab/ for more information on this vector can be found through
Proper citation: RRID:Addgene_37505 Copy
Vector Backbone Description: Backbone Marker:Andrew Fire (Addgene plasmid # 1494); Vector Backbone:pPD95.75; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22022276
Proper citation: RRID:Addgene_37464 Copy
Species: Homo sapiens
Genetic Insert: NLRC5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22490867
Proper citation: RRID:Addgene_37509 Copy
Genetic Insert: Histone, 2A element, rabies B19 glycoprotein
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Comments: Please note that there are 2 mutations in Histone, D26G and V119I. These mutations should not affect plasmid function.
Proper citation: RRID:Addgene_37452 Copy
Species: Homo sapiens
Genetic Insert: E6AP III
Vector Backbone Description: Backbone Size:7800; Vector Backbone:PHAGE-P CMVt N-HA GAW; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22645313
Proper citation: RRID:Addgene_37605 Copy
Species: HPV
Genetic Insert: HPV 16E6no*
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:9387; Vector Backbone:pLenti 6.3/V5 DEST; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22553330
Proper citation: RRID:Addgene_37445 Copy
Species: Homo sapiens
Genetic Insert: MET
Vector Backbone Description: Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37561 Copy
Species: Homo sapiens
Genetic Insert: MET
Vector Backbone Description: Backbone Marker:Eric Campeau Addgene Plasmid 17448; Backbone Size:8608; Vector Backbone:pLentiCMV GFP Puro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_37560 Copy
Species: Homo sapiens
Genetic Insert: Huwe1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2717; Vector Backbone:pENTR1A; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Comments: Full-length cDNA constructed by sequential cloning of PCR products and adding to a partial cDNA.
The ORF sequence provided contains Q2315H and 3016del3031 amino acid mutations compared to closest reference sequence NP_113584.3).
Proper citation: RRID:Addgene_37432 Copy
Species: Homo sapiens
Genetic Insert: IRF-9 STAT2 C
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12574168
Comments: C8Y point mutation in IRF9 should not affect plasmid function.
Proper citation: RRID:Addgene_37544 Copy
Species: Homo sapiens
Genetic Insert: Rabenosyn5
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22308388
Comments: Designed and prepared by Deborah Leonard, Deanna Navaroli and Anil Chawla (Corvera Lab)
Proper citation: RRID:Addgene_37538 Copy
Species: Homo sapiens
Genetic Insert: AK3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5597; Vector Backbone:pcDNA3.1(+) hygro; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21698293
Proper citation: RRID:Addgene_37539 Copy
Species: Homo sapiens
Genetic Insert: cysteine-free SGFP2-N
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4105; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22649538
Proper citation: RRID:Addgene_37533 Copy
Species: Homo sapiens
Genetic Insert: ss-cfSGFP2 (cysteine-free SGFP2)
Vector Backbone Description: Backbone Marker:Clonetech; Backbone Size:4105; Vector Backbone:pEGFP-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22649538
Comments: This plasmid is used for expression of cfSGFP2 in the ER. The cleaved signal sequence of α1-antitrypsin (M1-K34) was fused to the N-terminus of SGFP2 using BglII and EcoRI sites. The fragment M1-A24 should be removed cotranslationally after translocation. The long flanking sequence E25-K34 of α1-antitrypsin was included to ensure access to signal peptidase
Proper citation: RRID:Addgene_37535 Copy
Species: Homo sapiens
Genetic Insert: NLRC5
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22490867
Comments: The iso3 plasmid actually encodes the full cDNA (not only the ORF).
In comparison to the FL NLRC5, iso3 contains an insert that leads to a stop codon according to IPI00647281.1 .
Proper citation: RRID:Addgene_37510 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
