Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: Cas9
Vector Backbone Description: Backbone Marker:Dr. James Sutherland ; Backbone Size:6600; Vector Backbone:pAc-STABLE1-Puro; Vector Types:Insect Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24326186
Comments: gRNA target sequence GGTTTTGGACACTGGAACCG
Proper citation: RRID:Addgene_49331 Copy
Species: Synthetic
Genetic Insert: GBP7-p65 transactivation domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49441 Copy
Species: Synthetic
Genetic Insert: GPD-roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331
Proper citation: RRID:Addgene_49436 Copy
Species: Synthetic
Genetic Insert: roGFP2
Vector Backbone Description: Backbone Marker:ViraQuest Inc.; Backbone Size:5217; Vector Backbone:VQ Ad5CMV K-NpA; Vector Types:Mammalian Expression, Adenoviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20019331
Proper citation: RRID:Addgene_49435 Copy
Species: Synthetic
Genetic Insert: GBP2-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49439 Copy
Species: Synthetic
Genetic Insert: GBP1-Gal4 DNA binding domain fusion protein
Vector Backbone Description: Backbone Size:4823; Vector Backbone:pCAG-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: The GBP1 used differs from the PDB GBP1 by two amino acids. One is Q3D at a site away from the GFP binding pocket and not expected to affect GFP binding. The second was a C98S mutation to enhance protein solubility.
Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_49438 Copy
Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157
Proper citation: RRID:Addgene_49646 Copy
Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157
Proper citation: RRID:Addgene_49645 Copy
Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157
Proper citation: RRID:Addgene_49643 Copy
Species: Synthetic
Genetic Insert: TelR15
Vector Backbone Description: Backbone Marker:Pierce; Backbone Size:3600; Vector Backbone:pT7CFE1; Vector Types:In vitro Translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24324157
Proper citation: RRID:Addgene_49647 Copy
Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405
Proper citation: RRID:Addgene_49712 Copy
Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405
Proper citation: RRID:Addgene_49711 Copy
Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405
Proper citation: RRID:Addgene_49710 Copy
Species: Synthetic
Genetic Insert: sfgfp
Vector Backbone Description: Vector Backbone:pVRb; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24169405
Proper citation: RRID:Addgene_49713 Copy
Species: Synthetic
Genetic Insert: hCas9
Vector Backbone Description: Vector Backbone:pICH41308; Vector Types:CRISPR; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:24112467
Comments: BsaI and BbsI sites have been removed from the sequence by site-directed mutagenesis, however the amino acid sequence is as in the original hCas9.
Proper citation: RRID:Addgene_49770 Copy
Species: Synthetic
Genetic Insert: sgRNA_PDS2-Cas9-sgRNA_PDS1
Vector Backbone Description: Vector Backbone:pAGM4723; Vector Types:Plant Expression, CRISPR; Bacterial Resistance:Kanamycin
Defining Citation: PMID:24112467
Comments: We removed BsaI and BbsI sites from hCas9 preserving the amino acid composition. The construct was assembled using the Golden Gate system from S. Marillonnet.
Proper citation: RRID:Addgene_49772 Copy
Species: Synthetic
Genetic Insert: plamodium falciparum TRAP
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23236185
Proper citation: RRID:Addgene_50048 Copy
Species: Synthetic
Genetic Insert: pfTRAP(vwa)
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pIRES2-EGFP; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23236185
Proper citation: RRID:Addgene_50049 Copy
Species: Synthetic
Genetic Insert: G-CaMP3
Vector Backbone Description: Vector Backbone:AAV; Vector Types:AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23364746
Comments: NOTE: There are some discrepancies between the Addgene quality control sequence and the depositor's full assembled sequence. These differences are not in functionally relevant parts of the plasmid.
Proper citation: RRID:Addgene_50022 Copy
Species: Synthetic
Genetic Insert: Gal4DBD-GBP2-IRES-NLS-GBP7-p65AD
Vector Backbone Description: Backbone Size:4086; Vector Backbone:pCS2+; Vector Types:Multi-purpose expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23953120
Comments: Kirchhofer, A. et al. (2010). Modulation of protein properties in living cells using nanobodies. Nat. Struct. Mol. Biol. 17, 133–138.
Tang J.C. et al. (2013). A nanobody-based system using fluorescent proteins as scaffolds for cell-specific gene manipulation. Cell. 2013 Aug 15;154(4):928-39.
Proper citation: RRID:Addgene_50020 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.