Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: RRP4
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4230; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_64870 Copy
Species: Homo sapiens
Genetic Insert: FLJ10081
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:5070; Vector Backbone:pcDNA5FRT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20018852
Proper citation: RRID:Addgene_64775 Copy
Species: Homo sapiens
Genetic Insert: ATF6a-AD (1-150)
Vector Backbone Description: Backbone Marker:EMD Biosciences; Backbone Size:5900; Vector Backbone:pET41s; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22577136
Proper citation: RRID:Addgene_64774 Copy
Species: Homo sapiens
Genetic Insert: miR-34a promoter P4
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599
Proper citation: RRID:Addgene_64788 Copy
Species: Homo sapiens
Genetic Insert: miR-34a promoter P5
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599
Proper citation: RRID:Addgene_64789 Copy
Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Backbone Marker:Qiagen; Vector Backbone:pQE-60; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18469822
Comments: Discrepancies between the QC and full sequence have no functional consequence.
Proper citation: RRID:Addgene_64799 Copy
Species: Homo sapiens
Genetic Insert: Lin28b promoter P3
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19211792
Proper citation: RRID:Addgene_64794 Copy
Species: Homo sapiens
Genetic Insert: miR-34a promoter P6
Vector Backbone Description: Backbone Marker:Joshua Mendell; Backbone Size:5408; Vector Backbone:pGL3-Basic-IRES; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17540599
Proper citation: RRID:Addgene_64790 Copy
Species: Homo sapiens
Genetic Insert: syndecan 2
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24662262
Comments: Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF).
Proper citation: RRID:Addgene_64972 Copy
Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22100409
Comments: Sequence discrepancies found during QC should not affect function
Proper citation: RRID:Addgene_64999 Copy
Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Vector Backbone:pEIGW; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18469822
Comments: Sequence discrepancies found during QC should not affect function
Proper citation: RRID:Addgene_64990 Copy
Species: Homo sapiens
Genetic Insert: hnRNPM
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4219; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Proper citation: RRID:Addgene_64924 Copy
Species: Homo sapiens
Genetic Insert: TORCAR(T/A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25772363
Proper citation: RRID:Addgene_64928 Copy
Species: Homo sapiens
Genetic Insert: TORCAR
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25772363
Proper citation: RRID:Addgene_64927 Copy
Species: Homo sapiens
Genetic Insert: POLN
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDEST17; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20144948
Proper citation: RRID:Addgene_64885 Copy
Species: Homo sapiens
Genetic Insert: RegIIIa
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:4640; Vector Backbone:pET3a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19095652
Proper citation: RRID:Addgene_64937 Copy
Species: Homo sapiens
Genetic Insert: LAMP1-AktAR2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25772363
Proper citation: RRID:Addgene_64933 Copy
Species: Homo sapiens
Genetic Insert: CREB1 Homology Arms
Vector Backbone Description: Backbone Size:5771; Vector Backbone:pFETCH_Donor; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:26355004
Comments: This plasmid has been used along with PX548_CREB1_1 and PX548_CREB1_2 to add a FLAG tag to human CREB in HepG2 cells by the Mendenhall and Myers labs at HudsonAlpha Institute for Biotechnology/UAH Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.
Proper citation: RRID:Addgene_64938 Copy
Species: Homo sapiens
Genetic Insert: Glutaredoxin-1
Vector Backbone Description: Vector Backbone:pCaSpeR4; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22100409
Comments: Sequence discrepancies found during QC should not affect function
Proper citation: RRID:Addgene_65000 Copy
Species: Homo sapiens
Genetic Insert: RBPMS
Vector Backbone Description: Backbone Marker:Life Technologies, Modified by Tuschl lab; Backbone Size:5372; Vector Backbone:pcDNA5/FRT/TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:26347403
Proper citation: RRID:Addgene_65095 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
