Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Synthetic
Genetic Insert: RVD sequence: NI HD HD NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48390 Copy
Vector Backbone Description: Backbone Size:8937; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.
This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector has a TEV cleavable His6 tag on the N-terminus and can complement Ura auxotrophy.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48304 Copy
Vector Backbone Description: Backbone Size:7773; Vector Backbone:pRS424; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.
This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Trp auxotrophy.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).
For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48302 Copy
Vector Backbone Description: Backbone Size:10092; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.
This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Ura auxotrophy.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).
For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48305 Copy
Vector Backbone Description: Backbone Size:8878; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.
This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector can complement Ura auxotrophy.
Add the following tags to your PCR primers:
Note: You must add an ATG to the beginning of your open reading frame.
LICvBac Forward Tag TACTTCCAATCCAATCG
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).
For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48306 Copy
Vector Backbone Description: Backbone Size:8429; Vector Backbone:pRS422; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function.
This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector can complement Ade auxotrophy.
Add the following tags to your PCR primers:
Note: You must add an ATG to the beginning of your open reading frame.
LICvBac Forward Tag TACTTCCAATCCAATCG
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).
For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/
Proper citation: RRID:Addgene_48300 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NI HD NI HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48385 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NI HD NI NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48386 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NI NI NN NG
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48379 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NI NI NN NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48376 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NI NI NN HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48377 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NI NI HD NG
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48375 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NI NI NI HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48369 Copy
Species: T. brucei
Genetic Insert: FLAG-intergenic region of TUB-HYG (modified from PMID 16269191)
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T Easy; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html
There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab. These mismatches should not affect plasmid function.
Proper citation: RRID:Addgene_48367 Copy
Species: Synthetic
Genetic Insert: RVD sequence: NI NI NI NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48368 Copy
Species: T. brucei
Genetic Insert: Partial beta-TUB followed by 5' ALD UTR-loxP-SAS-HYG-loxP-3' ALD UTR
Vector Backbone Description: Backbone Marker:Cross Lab; Vector Backbone:pHJ17; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html
There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab; most notably in the beta-tubulin ORF, HSV thymidine kinase and the T. brucei Aldolase 3'UTR. These mismatches should not affect plasmid function.
Proper citation: RRID:Addgene_48361 Copy
Species: T. brucei
Genetic Insert: 3XMYC-intergenic region of TUB-HYG (modified from PMID 16269191)
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T Easy; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html
Proper citation: RRID:Addgene_48365 Copy
Species: Synthetic
Genetic Insert: RVD sequence: HD NN NG NG
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48479 Copy
Species: Synthetic
Genetic Insert: RVD sequence: HD NN NG NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48478 Copy
Species: Synthetic
Genetic Insert: RVD sequence: HD NN NG HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.
Proper citation: RRID:Addgene_48477 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
