Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 480 showing 9581 ~ 9600 out of 178,636 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_48390

http://www.addgene.org/48390

Species: Synthetic
Genetic Insert: RVD sequence: NI HD HD NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48390 Copy   


http://www.addgene.org/48304

Vector Backbone Description: Backbone Size:8937; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6 tag on the N-terminus and can complement Ura auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-).For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48304 Copy   


http://www.addgene.org/48302

Vector Backbone Description: Backbone Size:7773; Vector Backbone:pRS424; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Trp auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48302 Copy   


http://www.addgene.org/48305

Vector Backbone Description: Backbone Size:10092; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector has a TEV cleavable His6-MBP tag on the N-terminus and can complement Ura auxotrophy. Add the following tags to your PCR primers: LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG) LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48305 Copy   


http://www.addgene.org/48306

Vector Backbone Description: Backbone Size:8878; Vector Backbone:pRS426; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector can complement Ura auxotrophy. Add the following tags to your PCR primers: Note: You must add an ATG to the beginning of your open reading frame. LICvBac Forward Tag TACTTCCAATCCAATCG LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48306 Copy   


http://www.addgene.org/48300

Vector Backbone Description: Backbone Size:8429; Vector Backbone:pRS422; Vector Types:NA; Bacterial Resistance:Ampicillin
Comments: Note: The full plasmid sequence displayed here is theoretical and may not be entirely accurate. Addgene's quality control sequencing has identified some discrepancies with the sequence, but they do not impact the plasmid's function. This plasmid is a LIC-adapted S. cerevisiae vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once. This vector can complement Ade auxotrophy. Add the following tags to your PCR primers: Note: You must add an ATG to the beginning of your open reading frame. LICvBac Forward Tag TACTTCCAATCCAATCG LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP. Series 12 vectors are galactose inducible (using the Gal 1/10 promoter). The plasmids are cloned and propagated in E. coli. Plasmids are available to complement the Ade, Trp, or Ura auxotrophies. The Ade, Trp, and Ura plasmids can co-exist in the same yeast cell with no compatibility issues. We have successfully expressed 3 proteins from these 3 plasmids in the same strain (BCY123: Ade-, Trp-, Ura-). For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

Proper citation: RRID:Addgene_48300 Copy   


  • RRID:Addgene_48385

http://www.addgene.org/48385

Species: Synthetic
Genetic Insert: RVD sequence: NI HD NI HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48385 Copy   


  • RRID:Addgene_48386

http://www.addgene.org/48386

Species: Synthetic
Genetic Insert: RVD sequence: NI HD NI NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48386 Copy   


  • RRID:Addgene_48379

http://www.addgene.org/48379

Species: Synthetic
Genetic Insert: RVD sequence: NI NI NN NG
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48379 Copy   


  • RRID:Addgene_48376

http://www.addgene.org/48376

Species: Synthetic
Genetic Insert: RVD sequence: NI NI NN NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48376 Copy   


  • RRID:Addgene_48377

http://www.addgene.org/48377

Species: Synthetic
Genetic Insert: RVD sequence: NI NI NN HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48377 Copy   


  • RRID:Addgene_48375

http://www.addgene.org/48375

Species: Synthetic
Genetic Insert: RVD sequence: NI NI HD NG
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48375 Copy   


  • RRID:Addgene_48369

http://www.addgene.org/48369

Species: Synthetic
Genetic Insert: RVD sequence: NI NI NI HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48369 Copy   


  • RRID:Addgene_48367

http://www.addgene.org/48367

Species: T. brucei
Genetic Insert: FLAG-intergenic region of TUB-HYG (modified from PMID 16269191)
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T Easy; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab. These mismatches should not affect plasmid function.

Proper citation: RRID:Addgene_48367 Copy   


  • RRID:Addgene_48368

http://www.addgene.org/48368

Species: Synthetic
Genetic Insert: RVD sequence: NI NI NI NI
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48368 Copy   


  • RRID:Addgene_48361

http://www.addgene.org/48361

Species: T. brucei
Genetic Insert: Partial beta-TUB followed by 5' ALD UTR-loxP-SAS-HYG-loxP-3' ALD UTR
Vector Backbone Description: Backbone Marker:Cross Lab; Vector Backbone:pHJ17; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html There are several mismatches between Addgene's quality control sequence and the reference sequence from the depositing lab; most notably in the beta-tubulin ORF, HSV thymidine kinase and the T. brucei Aldolase 3'UTR. These mismatches should not affect plasmid function.

Proper citation: RRID:Addgene_48361 Copy   


  • RRID:Addgene_48365

http://www.addgene.org/48365

Species: T. brucei
Genetic Insert: 3XMYC-intergenic region of TUB-HYG (modified from PMID 16269191)
Vector Backbone Description: Backbone Marker:Promega; Vector Backbone:pGEM-T Easy; Vector Types:Cre/Lox, Knockout in T. Brucei; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23954366
Comments: For additional information, see http://tryps.rockefeller.edu/trypsru2_cre-lox.html

Proper citation: RRID:Addgene_48365 Copy   


  • RRID:Addgene_48479

http://www.addgene.org/48479

Species: Synthetic
Genetic Insert: RVD sequence: HD NN NG NG
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48479 Copy   


  • RRID:Addgene_48478

http://www.addgene.org/48478

Species: Synthetic
Genetic Insert: RVD sequence: HD NN NG NN
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48478 Copy   


  • RRID:Addgene_48477

http://www.addgene.org/48477

Species: Synthetic
Genetic Insert: RVD sequence: HD NN NG HD
Vector Backbone Description: Vector Backbone:pFUS_B4; Vector Types:Mammalian Expression, TALEN; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:23734242
Comments: Plasmid was created using Golden Gate cloning.

Proper citation: RRID:Addgene_48477 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X