Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: FRB
Vector Backbone Description: Backbone Size:3900; Vector Backbone:pCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:20581846
Comments: FRB is a small domain derived from full length mTOR. In brief, rapamycin binds to a protein called FKBP12. Rapamycin bound to FKBP12 inhibits mTOR signaling
Proper citation: RRID:Addgene_25920 Copy
Genetic Insert: CD41 promoter
Vector Backbone Description: Backbone Marker:promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Comments: The sequence of the promoter region of CD41 corresponds to positions -597 to +32 of the human GPIIb promoter (full length promoter) described in Sevinsky et al., Mol. Cell. Biol. 2004, 24(10):4534-4545.
Proper citation: RRID:Addgene_25801 Copy
Species: Drosophila melanogaster
Genetic Insert: p174
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pBluescript KS+; Vector Types:Bacterial Expression, Stratagene; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_25889 Copy
Species: Mus musculus
Genetic Insert: FSP27
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6100; Vector Backbone:pLNCX2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_25880 Copy
Species: Mus musculus
Genetic Insert: Brahma related gene 1
Vector Backbone Description: Backbone Marker:Toshio Kitamura; Backbone Size:4628; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20550931
Proper citation: RRID:Addgene_25855 Copy
Species: Mus musculus
Genetic Insert: Brg1 associated factor 155
Vector Backbone Description: Backbone Size:4628; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20550931
Proper citation: RRID:Addgene_25856 Copy
Species: Homo sapiens
Genetic Insert: DICER-Promoter upstream Ebox Mut
Vector Backbone Description: Backbone Size:5394; Vector Backbone:pGL3 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20550935
Proper citation: RRID:Addgene_25852 Copy
Species: Mus musculus
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Ivanova, NB; Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:18371338
Comments: This plasmid targets the open reading frame of p21. The 19mer target sequence is: TTAGGACTCAACCGTAATA
Proper citation: RRID:Addgene_25868 Copy
Genetic Insert: hsa-miR-34a promoter
Vector Backbone Description: Backbone Marker:promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Comments: The sequence of the promoter region of miR-34a corresponds to the one described by Raver-Shapira et al. Mol Cell. 2007;26:731–743.
Proper citation: RRID:Addgene_25799 Copy
Species: Mus musculus
Genetic Insert: loxP-Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc-loxP
Vector Backbone Description: Backbone Size:10600; Vector Backbone:mCol.loxneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20010831
Proper citation: RRID:Addgene_25795 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-30c
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Comments: miR-30c sequence: 5'TGTAAACATCCTACACTCTCAGC3'
Proper citation: RRID:Addgene_25797 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-150
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Proper citation: RRID:Addgene_25792 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-34a
Vector Backbone Description: Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Proper citation: RRID:Addgene_25791 Copy
Species: Homo sapiens
Genetic Insert: shRNA against human MYB
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:6400; Vector Backbone:pSIREN-RetroQ; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19584398
Proper citation: RRID:Addgene_25790 Copy
Species: Homo sapiens
Genetic Insert: human Cryptochrome 1
Vector Backbone Description: Backbone Size:5274; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_25843 Copy
Species: Homo sapiens
Genetic Insert: human Cryptochrome 2
Vector Backbone Description: Backbone Size:5274; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12627958
Proper citation: RRID:Addgene_25842 Copy
Genetic Insert: qQint
Vector Backbone Description: Backbone Size:6559; Vector Backbone:pAT19; Vector Types:bacterial gene inactivation; Bacterial Resistance:Erythromycin
Defining Citation: PMID:19775243
Comments: Between Addgene sequence and author sequence, there is a 12 nucleotide mismatched region. It is in the intron sequence, which needs to be replaced in order to use the plasmid and should not be of concern.
Proper citation: RRID:Addgene_25819 Copy
Species: Homo sapiens
Genetic Insert: Hypoxia inducible factor 2 alpha
Vector Backbone Description: Backbone Size:5140; Vector Backbone:HA-pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17220275
Proper citation: RRID:Addgene_25936 Copy
Species: Homo sapiens
Genetic Insert: RapR-p38
Vector Backbone Description: Backbone Size:4600; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20581846
Comments: Note that the Addgene quality control sequence does not match the author-supplied sequence exactly. There is NO PstI site at the end of the insert.
Proper citation: RRID:Addgene_25935 Copy
Species: Aq. Victoria and Discosoma sp
Genetic Insert: ClopHensor
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5363; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20581829
Proper citation: RRID:Addgene_25938 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
