Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCherry-FRB Resource Report Resource Website 1+ mentions |
RRID:Addgene_25920 | FRB | Homo sapiens | Kanamycin | PMID:20581846 | FRB is a small domain derived from full length mTOR. In brief, rapamycin binds to a protein called FKBP12. Rapamycin bound to FKBP12 inhibits mTOR signaling | Backbone Size:3900; Vector Backbone:pCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2026-08-29 01:02:54 | 5 | |
|
pGL3-PMT-CD41 Resource Report Resource Website |
RRID:Addgene_25801 | CD41 promoter | Ampicillin | PMID:19584398 | The sequence of the promoter region of CD41 corresponds to positions -597 to +32 of the human GPIIb promoter (full length promoter) described in Sevinsky et al., Mol. Cell. Biol. 2004, 24(10):4534-4545. | Backbone Marker:promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | ||
|
ninaC-15 Resource Report Resource Website |
RRID:Addgene_25889 | p174 | Drosophila melanogaster | Ampicillin | Backbone Size:3000; Vector Backbone:pBluescript KS+; Vector Types:Bacterial Expression, Stratagene; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | |||
|
(O75) FSP27/pLNCX2 Resource Report Resource Website |
RRID:Addgene_25880 | FSP27 | Mus musculus | Ampicillin | Backbone Marker:Clontech; Backbone Size:6100; Vector Backbone:pLNCX2; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | |||
|
pMX-Brg1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25855 | Brahma related gene 1 | Mus musculus | Ampicillin | PMID:20550931 | Backbone Marker:Toshio Kitamura; Backbone Size:4628; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 2 | ||
|
pMX-Baf155 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25856 | Brg1 associated factor 155 | Mus musculus | Ampicillin | PMID:20550931 | Backbone Size:4628; Vector Backbone:pMX; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 1 | ||
|
pGL3-DICER-Prom upstream Ebox Mut Resource Report Resource Website |
RRID:Addgene_25852 | DICER-Promoter upstream Ebox Mut | Homo sapiens | Ampicillin | PMID:20550935 | Backbone Size:5394; Vector Backbone:pGL3 basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | ||
|
p21 shRNA1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25868 | p21 | Mus musculus | Ampicillin | PMID:18371338 | This plasmid targets the open reading frame of p21. The 19mer target sequence is: TTAGGACTCAACCGTAATA | Backbone Marker:Ivanova, NB; Backbone Size:10130; Vector Backbone:FUGW-H1; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 3 | |
|
pGL3-PMT-miR-34a Resource Report Resource Website 1+ mentions |
RRID:Addgene_25799 | hsa-miR-34a promoter | Ampicillin | PMID:19584398 | The sequence of the promoter region of miR-34a corresponds to the one described by Raver-Shapira et al. Mol Cell. 2007;26:731–743. | Backbone Marker:promega; Backbone Size:4818; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 2 | ||
|
mCol.2lox4F2A targeting construct Resource Report Resource Website |
RRID:Addgene_25795 | loxP-Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc-loxP | Mus musculus | Ampicillin | PMID:20010831 | Backbone Size:10600; Vector Backbone:mCol.loxneo; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | ||
|
pLL3.7_hsa-miR-30c Resource Report Resource Website |
RRID:Addgene_25797 | hsa-miR-30c | Homo sapiens | Ampicillin | PMID:19584398 | miR-30c sequence: 5'TGTAAACATCCTACACTCTCAGC3' | Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 0 | |
|
pLL3.7_hsa-miR-150 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25792 | hsa-miR-150 | Homo sapiens | Ampicillin | PMID:19584398 | Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 1 | ||
|
pLL3.7_hsa-miR-34a Resource Report Resource Website 1+ mentions |
RRID:Addgene_25791 | hsa-miR-34a | Homo sapiens | Ampicillin | PMID:19584398 | Backbone Size:7650; Vector Backbone:pLL3.7; Vector Types:Lentiviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 4 | ||
|
pSIREN-RetroQ-MYB-shRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_25790 | shRNA against human MYB | Homo sapiens | Ampicillin | PMID:19584398 | Backbone Marker:Clontech; Backbone Size:6400; Vector Backbone:pSIREN-RetroQ; Vector Types:Mammalian Expression, Retroviral, RNAi; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 1 | ||
|
pfmh-hCry1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25843 | human Cryptochrome 1 | Homo sapiens | Ampicillin | Backbone Size:5274; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 6 | |||
|
pSO2002 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25842 | human Cryptochrome 2 | Homo sapiens | Ampicillin | PMID:12627958 | Backbone Size:5274; Vector Backbone:pcDNA4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:53 | 3 | ||
|
pQint Resource Report Resource Website |
RRID:Addgene_25819 | qQint | Erythromycin | PMID:19775243 | Between Addgene sequence and author sequence, there is a 12 nucleotide mismatched region. It is in the intron sequence, which needs to be replaced in order to use the plasmid and should not be of concern. | Backbone Size:6559; Vector Backbone:pAT19; Vector Types:bacterial gene inactivation; Bacterial Resistance:Erythromycin | plasmid to make targeted insertions in Clostridium phytofermentans chromosome using group II intron | 2026-08-29 01:02:53 | 0 | |
|
HA-HIF2α P405A/N847A Δ450-572-pBabe-Puro Resource Report Resource Website |
RRID:Addgene_25936 | Hypoxia inducible factor 2 alpha | Homo sapiens | Ampicillin | PMID:17220275 | Backbone Size:5140; Vector Backbone:HA-pBabe-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | cDNA changed amino acids: Proline 405 to Alanine Asparagine 847 to Alanine internal deletion of Amino acids 450 - 527 (NTAD = N-terminal transactivation domain) This mutant is called "M4" in Yan et al. 2007, Mol Cell Biol, 27, 209-2-102 . | 2026-08-29 01:02:54 | 0 | |
|
pCMV5-Flag-RapR-p38 Resource Report Resource Website 1+ mentions |
RRID:Addgene_25935 | RapR-p38 | Homo sapiens | Ampicillin | PMID:20581846 | Note that the Addgene quality control sequence does not match the author-supplied sequence exactly. There is NO PstI site at the end of the insert. | Backbone Size:4600; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-29 01:02:54 | 2 | |
|
pcDNA3-ClopHensor Resource Report Resource Website 1+ mentions |
RRID:Addgene_25938 | ClopHensor | Aq. Victoria and Discosoma sp | Ampicillin | PMID:20581829 | Backbone Marker:Invitrogen; Backbone Size:5363; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | E2GFP is EGFP-T203Y | 2026-08-29 01:02:54 | 9 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
