Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42050 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42051 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42042 Copy
Genetic Insert: TAP Tag::mTFP1
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42161 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42039 Copy
Genetic Insert: GFP
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42152 Copy
Genetic Insert: CFP-RT-CFP
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42156 Copy
Genetic Insert: GFP-RT-GFP
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42157 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42037 Copy
Genetic Insert: YFP-RT-YFP
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42158 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42038 Copy
Species: Synthetic
Genetic Insert: RT-cassette
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:7904; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition enabling stable propagation of RT-cassette. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42150 Copy
Species: Homo sapiens
Genetic Insert: TNRC6A
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23150874
Proper citation: RRID:Addgene_42030 Copy
Species: Caenorhabditis elegans
Genetic Insert: N-TAP TAG::[(G4S)3]::mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]
Proper citation: RRID:Addgene_42145 Copy
Species: Caenorhabditis elegans
Genetic Insert: N-TAP-tag::mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]
Proper citation: RRID:Addgene_42146 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTFP1
Vector Backbone Description: Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281894
Comments: Nb. CDS terminates with two in-frame stop codons [TAA-TAG]
Proper citation: RRID:Addgene_42147 Copy
Vector Backbone Description: Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Proper citation: RRID:Addgene_42250 Copy
Species: Danio rerio
Genetic Insert: gRNA-tia1l
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGTATGTCGGGAACCTCTCC
Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA
Proper citation: RRID:Addgene_42248 Copy
Species: Danio rerio
Genetic Insert: gRNA-drd3
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAAACTACAGCCCAGCGTC
Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA
Proper citation: RRID:Addgene_42242 Copy
Species: Danio rerio
Genetic Insert: gRNA-fh site #1
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGCGGTACATGGCGACCG
Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA
Proper citation: RRID:Addgene_42243 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.