Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pET-GST-TNRC6A-(935-984) Resource Report Resource Website |
RRID:Addgene_42050 | TNRC6A | Homo sapiens | Kanamycin | PMID:23150874 | Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | contain aa935-984 | 2026-08-15 01:14:50 | 0 | |
|
pET-GST-TNRC6A-(935-984)-NES-mut Resource Report Resource Website |
RRID:Addgene_42051 | TNRC6A | Homo sapiens | Kanamycin | PMID:23150874 | Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | contain aa935-984, F951A, F955A, I958A, F960A | 2026-08-15 01:14:50 | 0 | |
|
pmyc-GFP-TNRC6A-del.GW-I+III-NES-mut Resource Report Resource Website |
RRID:Addgene_42042 | TNRC6A | Homo sapiens | Ampicillin | PMID:23150874 | Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted aa457-532 and aa804-924, F951A, F955A, I958A, F960A | 2026-08-15 01:14:50 | 0 | |
|
pNH058 Resource Report Resource Website |
RRID:Addgene_42161 | TAP Tag::mTFP1 | Chloramphenicol and Ampicillin | PMID:23281894 | Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. | Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:51 | 0 | ||
|
pmyc-GFP-TNRC6A-del.GW-I+II-NES-mut Resource Report Resource Website |
RRID:Addgene_42039 | TNRC6A | Homo sapiens | Ampicillin | PMID:23150874 | Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted aa457-532 and aa716-772, F951A, F955A, I958A, F960A | 2026-08-15 01:14:50 | 0 | |
|
pNH040 Resource Report Resource Website |
RRID:Addgene_42152 | GFP | Chloramphenicol and Ampicillin | PMID:23281894 | Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. | Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin | 2026-08-15 01:14:51 | 0 | ||
|
pNH050 Resource Report Resource Website |
RRID:Addgene_42156 | CFP-RT-CFP | Chloramphenicol and Tetracycline | PMID:23281894 | Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. | Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline | 2026-08-15 01:14:51 | 0 | ||
|
pNH051 Resource Report Resource Website |
RRID:Addgene_42157 | GFP-RT-GFP | Chloramphenicol and Tetracycline | PMID:23281894 | Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. | Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline | 2026-08-15 01:14:51 | 0 | ||
|
pmyc-GFP-TNRC6A-del.GW-I-NES-mut Resource Report Resource Website |
RRID:Addgene_42037 | TNRC6A | Homo sapiens | Ampicillin | PMID:23150874 | Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted aa457-532, F951A, F955A, I958A, F960A | 2026-08-15 01:14:50 | 0 | |
|
pNH052 Resource Report Resource Website |
RRID:Addgene_42158 | YFP-RT-YFP | Chloramphenicol and Tetracycline | PMID:23281894 | Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. | Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline | 2026-08-15 01:14:51 | 0 | ||
|
pmyc-GFP-TNRC6A-del.GW-II-NES-mut Resource Report Resource Website |
RRID:Addgene_42038 | TNRC6A | Homo sapiens | Ampicillin | PMID:23150874 | Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted aa716-772, F951A, F955A, I958A, F960A | 2026-08-15 01:14:50 | 0 | |
|
pNH034 Resource Report Resource Website 1+ mentions |
RRID:Addgene_42150 | RT-cassette | Synthetic | Chloramphenicol and Tetracycline | PMID:23281894 | Single-copy vector under non-induced condition enabling stable propagation of RT-cassette. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. | Backbone Marker:Eipcentre; Backbone Size:7904; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline | 2026-08-15 01:14:51 | 1 | |
|
pmyc-GFP-TNRC6A-del.GW-I Resource Report Resource Website |
RRID:Addgene_42030 | TNRC6A | Homo sapiens | Ampicillin | PMID:23150874 | Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | deleted aa457-532 | 2026-08-15 01:14:49 | 0 | |
|
pNH002 Resource Report Resource Website |
RRID:Addgene_42145 | N-TAP TAG::[(G4S)3]::mTFP1 | Caenorhabditis elegans | Ampicillin | PMID:23281894 | Nb. CDS terminates with two in-frame stop codons [TAA-TAG] | Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 0 | |
|
pNH009 Resource Report Resource Website |
RRID:Addgene_42146 | N-TAP-tag::mTFP1 | Caenorhabditis elegans | Ampicillin | PMID:23281894 | Nb. CDS terminates with two in-frame stop codons [TAA-TAG] | Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 0 | |
|
pNH013 Resource Report Resource Website |
RRID:Addgene_42147 | mTFP1 | Caenorhabditis elegans | Ampicillin | PMID:23281894 | Nb. CDS terminates with two in-frame stop codons [TAA-TAG] | Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:51 | 0 | |
|
DR274 Resource Report Resource Website 100+ mentions |
RRID:Addgene_42250 | Kanamycin | PMID:23360964 | Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:52 | 213 | ||||
|
Zebrafish-gRNA-0008 Resource Report Resource Website |
RRID:Addgene_42248 | gRNA-tia1l | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGTATGTCGGGAACCTCTCC Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:52 | 0 | |
|
Zebrafish-gRNA-0002 Resource Report Resource Website |
RRID:Addgene_42242 | gRNA-drd3 | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGAAACTACAGCCCAGCGTC Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 0 | |
|
Zebrafish-gRNA-0003 Resource Report Resource Website |
RRID:Addgene_42243 | gRNA-fh site #1 | Danio rerio | Kanamycin | PMID:23360964 | Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA | Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin | 2026-08-15 01:14:51 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.