Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

740,584 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pET-GST-TNRC6A-(935-984)
 
Resource Report
Resource Website
RRID:Addgene_42050 TNRC6A Homo sapiens Kanamycin PMID:23150874 Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin contain aa935-984 2026-08-15 01:14:50 0
pET-GST-TNRC6A-(935-984)-NES-mut
 
Resource Report
Resource Website
RRID:Addgene_42051 TNRC6A Homo sapiens Kanamycin PMID:23150874 Backbone Size:5311; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin contain aa935-984, F951A, F955A, I958A, F960A 2026-08-15 01:14:50 0
pmyc-GFP-TNRC6A-del.GW-I+III-NES-mut
 
Resource Report
Resource Website
RRID:Addgene_42042 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted aa457-532 and aa804-924, F951A, F955A, I958A, F960A 2026-08-15 01:14:50 0
pNH058
 
Resource Report
Resource Website
RRID:Addgene_42161 TAP Tag::mTFP1 Chloramphenicol and Ampicillin PMID:23281894 Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:14:51 0
pmyc-GFP-TNRC6A-del.GW-I+II-NES-mut
 
Resource Report
Resource Website
RRID:Addgene_42039 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted aa457-532 and aa716-772, F951A, F955A, I958A, F960A 2026-08-15 01:14:50 0
pNH040
 
Resource Report
Resource Website
RRID:Addgene_42152 GFP Chloramphenicol and Ampicillin PMID:23281894 Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-15 01:14:51 0
pNH050
 
Resource Report
Resource Website
RRID:Addgene_42156 CFP-RT-CFP Chloramphenicol and Tetracycline PMID:23281894 Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-08-15 01:14:51 0
pNH051
 
Resource Report
Resource Website
RRID:Addgene_42157 GFP-RT-GFP Chloramphenicol and Tetracycline PMID:23281894 Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-08-15 01:14:51 0
pmyc-GFP-TNRC6A-del.GW-I-NES-mut
 
Resource Report
Resource Website
RRID:Addgene_42037 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted aa457-532, F951A, F955A, I958A, F960A 2026-08-15 01:14:50 0
pNH052
 
Resource Report
Resource Website
RRID:Addgene_42158 YFP-RT-YFP Chloramphenicol and Tetracycline PMID:23281894 Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-08-15 01:14:51 0
pmyc-GFP-TNRC6A-del.GW-II-NES-mut
 
Resource Report
Resource Website
RRID:Addgene_42038 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted aa716-772, F951A, F955A, I958A, F960A 2026-08-15 01:14:50 0
pNH034
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_42150 RT-cassette Synthetic Chloramphenicol and Tetracycline PMID:23281894 Single-copy vector under non-induced condition enabling stable propagation of RT-cassette. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc. Backbone Marker:Eipcentre; Backbone Size:7904; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline 2026-08-15 01:14:51 1
pmyc-GFP-TNRC6A-del.GW-I
 
Resource Report
Resource Website
RRID:Addgene_42030 TNRC6A Homo sapiens Ampicillin PMID:23150874 Backbone Size:5338; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin deleted aa457-532 2026-08-15 01:14:49 0
pNH002
 
Resource Report
Resource Website
RRID:Addgene_42145 N-TAP TAG::[(G4S)3]::mTFP1 Caenorhabditis elegans Ampicillin PMID:23281894 Nb. CDS terminates with two in-frame stop codons [TAA-TAG] Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 0
pNH009
 
Resource Report
Resource Website
RRID:Addgene_42146 N-TAP-tag::mTFP1 Caenorhabditis elegans Ampicillin PMID:23281894 Nb. CDS terminates with two in-frame stop codons [TAA-TAG] Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 0
pNH013
 
Resource Report
Resource Website
RRID:Addgene_42147 mTFP1 Caenorhabditis elegans Ampicillin PMID:23281894 Nb. CDS terminates with two in-frame stop codons [TAA-TAG] Backbone Marker:GeneOracle; Backbone Size:2172; Vector Backbone:pGOv5; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-15 01:14:51 0
DR274
 
Resource Report
Resource Website
100+ mentions
RRID:Addgene_42250 Kanamycin PMID:23360964 Backbone Marker:Joung lab DR274; Backbone Size:2147; Vector Backbone:Zebrafish-gRNA-ExpressionVector; Vector Types:Worm Expression, CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:52 213
Zebrafish-gRNA-0008
 
Resource Report
Resource Website
RRID:Addgene_42248 gRNA-tia1l Danio rerio Kanamycin PMID:23360964 Target site: GGTATGTCGGGAACCTCTCC Guide RNA sequence: TAATACGACTCACTATAGGTATGTCGGGAACCTCTCCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:52 0
Zebrafish-gRNA-0002
 
Resource Report
Resource Website
RRID:Addgene_42242 gRNA-drd3 Danio rerio Kanamycin PMID:23360964 Target site: GGAAACTACAGCCCAGCGTC Guide RNA sequence: TAATACGACTCACTATAGGAAACTACAGCCCAGCGTCGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0
Zebrafish-gRNA-0003
 
Resource Report
Resource Website
RRID:Addgene_42243 gRNA-fh site #1 Danio rerio Kanamycin PMID:23360964 Target site: GGAGCGGTACATGGCGACCG Guide RNA sequence: TAATACGACTCACTATAGGAGCGGTACATGGCGACCGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin 2026-08-15 01:14:51 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.