Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Danio rerio
Genetic Insert: gRNA-rgs4
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid# 42250); Backbone Size:2147; Vector Backbone:DR274; Vector Types:CRISPR, zebrafish expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:23360964
Comments: Target site: GGAGAAGGTGAAGGACACTG
Guide RNA sequence: TAATACGACTCACTATAGGAGAAGGTGAAGGACACTGGTTTTAGAGCTAGAAATAGCAAG TTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTAAA
Proper citation: RRID:Addgene_42246 Copy
Species: Homo sapiens
Genetic Insert: YAP1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2300; Vector Backbone:pEntr3c; Vector Types:Gateway Cloning; Bacterial Resistance:Kanamycin
Defining Citation: PMID:22308401
Proper citation: RRID:Addgene_42239 Copy
Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287718
Comments: Alternate plasmid name: pSpCas9(BB) (PX330)
For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/
Proper citation: RRID:Addgene_42230 Copy
Species: Synthetic
Genetic Insert: GR-GECO1.1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4100; Vector Backbone:pTorPE; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23256581
Proper citation: RRID:Addgene_42198 Copy
Species: Danio rerio
Genetic Insert: EGFP-Rpl10a
Vector Backbone Description: Backbone Size:6170; Vector Backbone:pT2KXIG; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23281262
Proper citation: RRID:Addgene_42236 Copy
Vector Backbone Description: Backbone Marker:Daugelat et al 2003; Backbone Size:6900; Vector Backbone:pSD26; Vector Types:Bacterial Expression; Bacterial Resistance:Hygromycin
Defining Citation: PMID:33006405
Comments: Vector constructed by Dr. Arie Geerlof at EMBL-Hamburg (now at Helmholtz Zentrum München)
Proper citation: RRID:Addgene_42192 Copy
Genetic Insert: humanized S. pyogenes Cas9
Vector Backbone Description: Vector Backbone:pUC ori vector; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23287718
Comments: Note, Addgene's quality control sequencing has found a few discrepancies with the depositor's full sequence. The depositing lab is aware of these discrepancies, and they are not thought to affect plasmid function.
For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/
Proper citation: RRID:Addgene_42229 Copy
Species: Mus musculus
Genetic Insert: G protein Gamma 3(F70A, F71A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23213235
Comments: Mutations created by using the Quik Change Mutagenesis kit.
Proper citation: RRID:Addgene_42185 Copy
Species: Synthetic
Genetic Insert: GR-GECO1.1
Vector Backbone Description: Backbone Size:3200; Vector Backbone:modified pcDNA3.1; Vector Types:; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23256581
Proper citation: RRID:Addgene_42186 Copy
Species: Mus musculus
Genetic Insert: Gamma 3(K68A,K69A,F70A,F71A)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23213235
Comments: Mutations created by using the Quik Change mutagenesis kit
Proper citation: RRID:Addgene_42189 Copy
Species: E. coli K-12
Genetic Insert: dam
Vector Backbone Description: Vector Backbone:pBAD18; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:12897023
Proper citation: RRID:Addgene_42216 Copy
Species: Homo sapiens
Genetic Insert: c-SRC (250-536) HA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10753943
Comments: All c-SRC mutants were generated by polymerase chain reaction using c-SRC (WT) (Addgene Plasmid #42202) as a template, and polymerase chain reaction products containing a minimal Kozak sequence were cloned into the HindIII and XhoI sites of pcDNA3. This construct contains amino acids 250-536 of human c-SRC followed by a carboxyl-terminal HA tag. All sequences were confirmed using an automated ABI DNA sequencer (Howard Hughes Nucleic Acid Facility, Duke University).
Alternate plasmid name: pcDNA3 c-SRC-SH1
Proper citation: RRID:Addgene_42209 Copy
Species: Caenorhabditis elegans
Genetic Insert: mTFP1-RT-::[(G4S)3]::C-TAP Tag
Vector Backbone Description: Backbone Marker:Eipcentre; Backbone Size:8353; Vector Backbone:pCC1Fos; Vector Types:; Bacterial Resistance:Chloramphenicol and Tetracycline
Defining Citation: PMID:23281894
Comments: Single-copy vector under non-induced condition. Copy-number-inducible with arabinose enables transient induction of copy-number for DNA isolation, etc.
Proper citation: RRID:Addgene_42167 Copy
Species: Mus musculus
Genetic Insert: Frizzled 6
Vector Backbone Description: Vector Backbone:pRK5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23095888
Proper citation: RRID:Addgene_42268 Copy
Species: Homo sapiens
Genetic Insert: FLJ10324A
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3EC8/ Use BL21(DE3)-R3-pRARE2 strain for expression.
Proper citation: RRID:Addgene_42414 Copy
Species: Homo sapiens
Genetic Insert: CTPS2A
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/2V4U/ Use BL21(DE3)-R3-pRARE2 strain for expression.
Proper citation: RRID:Addgene_42417 Copy
Species: Homo sapiens
Genetic Insert: DDX19A
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/3EWS/ Use BL21(DE3)-R3-pRARE2 strain for expression.
Proper citation: RRID:Addgene_42419 Copy
Species: Homo sapiens
Genetic Insert: BAK1A
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/2JCN/ Use BL21(DE3)-R3-pRARE2 strain for expression.
Proper citation: RRID:Addgene_42372 Copy
Species: Homo sapiens
Genetic Insert: UCK1A
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/2JEO/ Use BL21(DE3)-R3-pRARE2 strain for expression.
Proper citation: RRID:Addgene_42374 Copy
Species: Homo sapiens
Genetic Insert: UMPSA
Vector Backbone Description: Backbone Marker:SGC; Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: http://www.thesgc.org/structures/2JGY/ Use BL21(DE3)-R3-pRARE2 strain for expression.
Proper citation: RRID:Addgene_42375 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
