Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CCNT1
Vector Backbone Description: Backbone Marker:David Root (Addgene plasmid # 41392); Vector Backbone:pLX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27684187
Comments: Addgene's sequencing results found H519R, S566P, and P712S mutations compared to NCBI reference sequence NP_001231.2. These mutations are not known to affect CCNT1 function.
Proper citation: RRID:Addgene_98328 Copy
Genetic Insert: P2A-hygro
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene #52961); Backbone Size:15261; Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30894629
Comments: Double stranded oligonucleotides encoding sgRNA sequences can be cloned between the BsmBI restriction sites as for lentiCRISPRv2. The second MluI site in the original lentiCRISPRv2 plasmid was destroyed by Klenow end-filling and religation after MluI digestion. For target guide (sgRNA) sequence cloning instructions, please see https://www.addgene.org/52961 for the Zhang's lab lentiCRISPR v2 guide.
Proper citation: RRID:Addgene_98291 Copy
Genetic Insert: P2A-puro
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene #52961); Backbone Size:14877; Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30894629
Comments: P2A-antibiotic resistance gene cassettes from the plasmids in this deposit (https://www.addgene.org/depositing/74286/) can be cloned in place of the P2A-puro gene using the unique BamHI and MluI sites. The second MluI site in the original lentiCRISPRv2 plasmid was destroyed by Klenow end-filling and religation after MluI digestion. For target guide (sgRNA) sequence cloning instructions, please see https://www.addgene.org/52961 for the Zhang's lab lentiCRISPR v2 guide.
Proper citation: RRID:Addgene_98290 Copy
Genetic Insert: P2a-neo
Vector Backbone Description: Backbone Marker:Feng Zhang (Addgene #52961); Backbone Size:15072; Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30894629
Comments: Double stranded oligonucleotides encoding sgRNA sequences can be cloned between the BsmBI restriction sites as for lentiCRISPRv2. The second MluI site in the original lentiCRISPRv2 plasmid was destroyed by Klenow end-filling and religation after MluI digestion. For target guide (sgRNA) sequence cloning instructions, please see https://www.addgene.org/52961 for the Zhang's lab lentiCRISPR v2 guide.
Proper citation: RRID:Addgene_98292 Copy
Species: Homo sapiens
Genetic Insert: FERMT1
Vector Backbone Description: Backbone Marker:David Root (Addgene plasmid # 41392); Vector Backbone:pLX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27684187
Proper citation: RRID:Addgene_98333 Copy
Species: Other
Genetic Insert: HMG2(-309,-153)-HIS3-TEFM1
Vector Backbone Description: Vector Backbone:pRS423; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:28239415
Comments: Yeast gene fragments were amplified from CEN.PK strain. The relative sequences in plasmids are based on S288C genomic sequence.
Proper citation: RRID:Addgene_98301 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: pdc5(-277,-32)-PGAL2>ERG12>TNAT5-PTEF2>ERG8>TIDP1-TIDP1
Defining Citation: PMID:28239415
Comments: Yeast gene fragments were amplified from CEN.PK strain. The relative sequences in plasmids are based on S288C genomic sequence.
Proper citation: RRID:Addgene_98303 Copy
Species: Homo sapiens
Genetic Insert: TNFR1
Vector Backbone Description: Backbone Marker:MoBiTec; Vector Backbone:pcDNA3-Flag1-tdEosFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:22749881
Comments: fusion protein: TNFR1-tdEosfp
Proper citation: RRID:Addgene_98273 Copy
Species: Homo sapiens
Genetic Insert: BRD7A
Vector Backbone Description: Backbone Marker:Opher Gileadi (Addgene plasmid # 26103); Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: Use BL21(DE3)-R3-pRARE2 for expression. T7/lac regulated, N-terminal His-tag, TEV, LIC cloning using BsaI cleavage/T4 polymerase, SacB stuffer fragment, pET28 backbone. 5MQ1: http://www.thesgc.org/structures/5MQ1
Proper citation: RRID:Addgene_98245 Copy
Species: Homo sapiens
Genetic Insert: TCF7L2
Vector Backbone Description: Backbone Marker:David Root (Addgene plasmid # 41392); Vector Backbone:pLX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27684187
Proper citation: RRID:Addgene_98373 Copy
Species: Homo sapiens
Genetic Insert: ZNF217
Vector Backbone Description: Backbone Marker:David Root (Addgene plasmid # 41392); Vector Backbone:pLX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:27684187
Proper citation: RRID:Addgene_98384 Copy
Species: Homo sapiens
Genetic Insert: ID2
Vector Backbone Description: Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29161592
Comments: Gateway entry vector for expression of 3xFLAG ID2 (human)
Proper citation: RRID:Addgene_98390 Copy
Species: Other
Genetic Insert: Luciferase
Vector Backbone Description: Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin
Defining Citation: PMID:29161592
Comments: Gateway entry vector for expression of 3xFLAG Luciferase
Proper citation: RRID:Addgene_98391 Copy
Species: Homo sapiens
Genetic Insert: ID2
Vector Backbone Description: Backbone Marker:Addgene #25737; Backbone Size:13286; Vector Backbone:pSLIK-hygro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29161592
Comments: Lentiviral mammalian expression plasmid for inducible expression of 3xFLAG ID2 with hygromycin selection; recombined from Addgene #98390 and Addgene #25737.
Proper citation: RRID:Addgene_98394 Copy
Species: Other
Genetic Insert: Venus
Vector Backbone Description: Backbone Marker:Addgene #1767; Vector Backbone:pBABE-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29161592
Comments: Retroviral vector for Venus expression
Proper citation: RRID:Addgene_98396 Copy
Species: Homo sapiens
Genetic Insert: non-targeting randomized sequence
Vector Backbone Description: Backbone Marker:Dmitri Wiederschain ; Backbone Size:8758; Vector Backbone:Tet-pLKO-Puro (pLKO-Tet-On) Addgene #21915; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34650052
Proper citation: RRID:Addgene_98398 Copy
Species: Homo sapiens
Genetic Insert: Trx1 SSAAA
Vector Backbone Description: Vector Backbone:pQE60; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17557078
Proper citation: RRID:Addgene_98403 Copy
Genetic Insert: Genotype: MC4100 ∆clpPX
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:27732583
Comments: Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
Proper citation: RRID:Addgene_98417 Copy
Vector Backbone Description: Backbone Size:3100; Vector Backbone:Derived from pDMSD-Y2 (Kostecki et al., 2010, 10.1371/journal.pone.0009225); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:25080893
Proper citation: RRID:Addgene_98588 Copy
Species: Francisella
Genetic Insert: FnCpf1
Vector Backbone Description: Backbone Marker:Datsenko KA & Wanner BL (PMID:10829079); Vector Backbone:pKD46; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:30356638
Proper citation: RRID:Addgene_98592 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
