Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

32,424 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
CCNT1_pLX307
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98328 CCNT1 Homo sapiens Ampicillin PMID:27684187 Addgene's sequencing results found H519R, S566P, and P712S mutations compared to NCBI reference sequence NP_001231.2. These mutations are not known to affect CCNT1 function. Backbone Marker:David Root (Addgene plasmid # 41392); Vector Backbone:pLX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin H519R, S566P, and P712S 2026-09-01 10:05:38 1
lentiCRISPRv2 hygro
 
Resource Report
Resource Website
50+ mentions 		RRID:Addgene_98291 P2A-hygro Ampicillin PMID:30894629 Double stranded oligonucleotides encoding sgRNA sequences can be cloned between the BsmBI restriction sites as for lentiCRISPRv2. The second MluI site in the original lentiCRISPRv2 plasmid was destroyed by Klenow end-filling and religation after MluI digestion. For target guide (sgRNA) sequence cloning instructions, please see https://www.addgene.org/52961 for the Zhang's lab lentiCRISPR v2 guide. Backbone Marker:Feng Zhang (Addgene #52961); Backbone Size:15261; Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 10:05:38 84
lentiCRISPRv2 puro
 
Resource Report
Resource Website
100+ mentions 		RRID:Addgene_98290 P2A-puro Ampicillin PMID:30894629 P2A-antibiotic resistance gene cassettes from the plasmids in this deposit (https://www.addgene.org/depositing/74286/) can be cloned in place of the P2A-puro gene using the unique BamHI and MluI sites. The second MluI site in the original lentiCRISPRv2 plasmid was destroyed by Klenow end-filling and religation after MluI digestion. For target guide (sgRNA) sequence cloning instructions, please see https://www.addgene.org/52961 for the Zhang's lab lentiCRISPR v2 guide. Backbone Marker:Feng Zhang (Addgene #52961); Backbone Size:14877; Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 10:05:38 256
lentiCRISPRv2 neo
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_98292 P2a-neo Ampicillin PMID:30894629 Double stranded oligonucleotides encoding sgRNA sequences can be cloned between the BsmBI restriction sites as for lentiCRISPRv2. The second MluI site in the original lentiCRISPRv2 plasmid was destroyed by Klenow end-filling and religation after MluI digestion. For target guide (sgRNA) sequence cloning instructions, please see https://www.addgene.org/52961 for the Zhang's lab lentiCRISPR v2 guide. Backbone Marker:Feng Zhang (Addgene #52961); Backbone Size:15072; Vector Backbone:lentiCRISPRv2; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin 2026-09-01 10:05:38 29
FERMT1_pLX307
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98333 FERMT1 Homo sapiens Ampicillin PMID:27684187 Backbone Marker:David Root (Addgene plasmid # 41392); Vector Backbone:pLX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-01 10:05:38 1
pIMVAu1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98301 HMG2(-309,-153)-HIS3-TEFM1ACS2>TACS2-PGAL2> EfmvaE >TEBS1-PGAL7>HMG2K6A(1,292) Other Ampicillin PMID:28239415 Yeast gene fragments were amplified from CEN.PK strain. The relative sequences in plasmids are based on S288C genomic sequence. Vector Backbone:pRS423; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-01 10:05:38 1
pIMVAd39T
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98303 pdc5(-277,-32)-PGAL2>ERG12>TNAT5-PTEF2>ERG8>TIDP1-TIDP1 Saccharomyces cerevisiae Ampicillin PMID:28239415 Yeast gene fragments were amplified from CEN.PK strain. The relative sequences in plasmids are based on S288C genomic sequence. Vector Backbone:pUC19; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-09-01 10:05:38 1
pTNFR1-tdEOS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98273 TNFR1 Homo sapiens Ampicillin PMID:22749881 fusion protein: TNFR1-tdEosfp Backbone Marker:MoBiTec; Vector Backbone:pcDNA3-Flag1-tdEosFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-01 10:05:37 2
BRD7 (BRD7A-c005)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98245 BRD7A Homo sapiens Kanamycin Use BL21(DE3)-R3-pRARE2 for expression. T7/lac regulated, N-terminal His-tag, TEV, LIC cloning using BsaI cleavage/T4 polymerase, SacB stuffer fragment, pET28 backbone. 5MQ1: http://www.thesgc.org/structures/5MQ1 Backbone Marker:Opher Gileadi (Addgene plasmid # 26103); Vector Backbone:pNIC28-Bsa4; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin pfam00439:Bromodomain 136-223 2026-09-01 10:05:37 2
TCF7L2_pLX307
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98373 TCF7L2 Homo sapiens Ampicillin PMID:27684187 Backbone Marker:David Root (Addgene plasmid # 41392); Vector Backbone:pLX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin Isoform X25 2026-09-01 10:05:39 1
ZNF217_pLX307
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98384 ZNF217 Homo sapiens Ampicillin PMID:27684187 Backbone Marker:David Root (Addgene plasmid # 41392); Vector Backbone:pLX307; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-01 10:05:39 1
pEN_TT 3xFLAG ID2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98390 ID2 Homo sapiens Gentamicin PMID:29161592 Gateway entry vector for expression of 3xFLAG ID2 (human) Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-09-01 10:05:39 1
pEN_TT 3xFLAG Luciferase
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98391 Luciferase Other Gentamicin PMID:29161592 Gateway entry vector for expression of 3xFLAG Luciferase Backbone Marker:Addgene #83274; Backbone Size:4496; Vector Backbone:pEN_TTmiRc2; Vector Types:Gateway Cloning; Bacterial Resistance:Gentamicin 2026-09-01 10:05:39 1
pSLIK TT 3xFLAG ID2 hygro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98394 ID2 Homo sapiens Ampicillin PMID:29161592 Lentiviral mammalian expression plasmid for inducible expression of 3xFLAG ID2 with hygromycin selection; recombined from Addgene #98390 and Addgene #25737. Backbone Marker:Addgene #25737; Backbone Size:13286; Vector Backbone:pSLIK-hygro; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin 2026-09-01 10:05:39 2
pBabe NEO Venus
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98396 Venus Other Ampicillin PMID:29161592 Retroviral vector for Venus expression Backbone Marker:Addgene #1767; Vector Backbone:pBABE-neo; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin 2026-09-01 10:05:39 1
pLKO-Tet-On-shRNA-Control
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_98398 non-targeting randomized sequence Homo sapiens Ampicillin PMID:34650052 Backbone Marker:Dmitri Wiederschain ; Backbone Size:8758; Vector Backbone:Tet-pLKO-Puro (pLKO-Tet-On) Addgene #21915; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin 2026-09-01 10:05:39 10
pQE60 Trx1 SSAAA
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98403 Trx1 SSAAA Homo sapiens Ampicillin PMID:17557078 Vector Backbone:pQE60; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin C32S, C35S, C62A, C69A, C73A 2026-09-01 10:05:39 1
DHL708
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98417 Genotype: MC4100 ∆clpPX Streptomycin PMID:27732583 Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20). The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC. Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012). Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin 2026-09-01 10:05:40 1
pCML 220
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98588 Kanamycin PMID:25080893 Backbone Size:3100; Vector Backbone:Derived from pDMSD-Y2 (Kostecki et al., 2010, 10.1371/journal.pone.0009225); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin 2026-09-01 10:05:41 1
p46Cpf1-OP2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_98592 FnCpf1 Francisella Chloramphenicol PMID:30356638 Backbone Marker:Datsenko KA & Wanner BL (PMID:10829079); Vector Backbone:pKD46; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Chloramphenicol Codon optimized for E. coli 2026-09-01 10:05:41 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch