Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: ZF-ACA synthetic transcription factor
Vector Backbone Description: Backbone Size:5344; Vector Backbone:pET-21a; Vector Types:cell-free transcription–translation; Bacterial Resistance:Ampicillin
Defining Citation: PMID:30850530
Comments: Integrating Gene Synthesis and Microfluidic Protein Analysis for Rapid Protein Engineering. NAR. 2016 April; 44(7): e68. doi:10.1093/nar/gkv1497.
Proper citation: RRID:Addgene_127466 Copy
Species: Homo sapiens
Genetic Insert: EGFP reverse complement coding sequence flanked by attB/attP Integrase 2 attachment sites.
Vector Backbone Description: Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32444777
Comments: The EGFP coding sequence in a reverse complement orientation flanked by attB and attP integrase 2 attachment sites were cloned into pEF-GFP plasmid (Addgene #11154) replacing the original EGFP forward coding sequence. The attB/P integrase 2 attachment sites sequences were obtained from Yang, L. et al. Nat. Methods 11, 1261-1266 (2014).
Proper citation: RRID:Addgene_127504 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Ndi-1
Vector Backbone Description: Backbone Marker:Invitrogen ; Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His(-)A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34852219
Proper citation: RRID:Addgene_127503 Copy
Species: Homo sapiens
Genetic Insert: NDUFS2 K62A
Vector Backbone Description: Backbone Marker:Invitrogen ; Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His(-)A; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:34852219
Proper citation: RRID:Addgene_127501 Copy
Species: Vaccinia Virus
Genetic Insert: VV.Orf60
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA 3.1D V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15623576
Comments: Please see the Vaccinia kit page ( https://www.addgene.org/vvorf/ ) for more information. The kit page contains the supplemental VVOrfData spreadsheet, which includes important information about this plasmid. The plasmid and insert names provided here relate only to this library. The name of the ORF (if present) in VACV strain Copenhagen and the name of the ORF (if annotated) in VACV strain WR sequence can be found in VVOrfData spreadsheet. Please note that the amino acid sequence given for each ORF in the spreadsheet may contain some errors. Additionally, changes from the expected sequence may be present in these plasmids. Please see Addgene's quality control sequence and sequencing notes in the VVOrfData spreadsheet before ordering this plasmid.
Proper citation: RRID:Addgene_12748 Copy
Species: Vaccinia Virus
Genetic Insert: VV.Orf61
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA 3.1D V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15623576
Comments: Please see the Vaccinia kit page ( https://www.addgene.org/vvorf/ ) for more information. The kit page contains the supplemental VVOrfData spreadsheet, which includes important information about this plasmid. The plasmid and insert names provided here relate only to this library. The name of the ORF (if present) in VACV strain Copenhagen and the name of the ORF (if annotated) in VACV strain WR sequence can be found in VVOrfData spreadsheet. Please note that the amino acid sequence given for each ORF in the spreadsheet may contain some errors. Additionally, changes from the expected sequence may be present in these plasmids. Please see Addgene's quality control sequence and sequencing notes in the VVOrfData spreadsheet before ordering this plasmid.
Proper citation: RRID:Addgene_12749 Copy
Species: Vaccinia Virus
Genetic Insert: VV.Orf58
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA 3.1D V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15623576
Comments: Please see the Vaccinia kit page ( https://www.addgene.org/vvorf/ ) for more information. The kit page contains the supplemental VVOrfData spreadsheet, which includes important information about this plasmid. The plasmid and insert names provided here relate only to this library. The name of the ORF (if present) in VACV strain Copenhagen and the name of the ORF (if annotated) in VACV strain WR sequence can be found in VVOrfData spreadsheet. Please note that the amino acid sequence given for each ORF in the spreadsheet may contain some errors. Additionally, changes from the expected sequence may be present in these plasmids. Please see Addgene's quality control sequence and sequencing notes in the VVOrfData spreadsheet before ordering this plasmid.
Proper citation: RRID:Addgene_12746 Copy
Species: Vaccinia Virus
Genetic Insert: VV.Orf59
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA 3.1D V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15623576
Comments: Please see the Vaccinia kit page ( https://www.addgene.org/vvorf/ ) for more information. The kit page contains the supplemental VVOrfData spreadsheet, which includes important information about this plasmid. The plasmid and insert names provided here relate only to this library. The name of the ORF (if present) in VACV strain Copenhagen and the name of the ORF (if annotated) in VACV strain WR sequence can be found in VVOrfData spreadsheet. Please note that the amino acid sequence given for each ORF in the spreadsheet may contain some errors. Additionally, changes from the expected sequence may be present in these plasmids. Please see Addgene's quality control sequence and sequencing notes in the VVOrfData spreadsheet before ordering this plasmid.
Proper citation: RRID:Addgene_12747 Copy
Species: Homo sapiens
Genetic Insert: EGFP reverse complement coding sequence flanked by attB/attP Integrase 4 attachment sites.
Vector Backbone Description: Vector Backbone:pEF-GFP; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:32444777
Comments: The EGFP coding sequence in a reverse complement orientation flanked by attB and attP integrase 4 attachment sites were cloned into pEF-GFP plasmid (Addgene #11154) replacing the original EGFP forward coding sequence. The attB/P integrase 2 attachment sites sequences were obtained from Yang, L. et al. Nat. Methods 11, 1261-1266 (2014).
Proper citation: RRID:Addgene_127505 Copy
Species: Vaccinia Virus
Genetic Insert: VV.Orf63
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5514; Vector Backbone:pcDNA 3.1D V5-His-TOPO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15623576
Comments: Please see the Vaccinia kit page ( https://www.addgene.org/vvorf/ ) for more information. The kit page contains the supplemental VVOrfData spreadsheet, which includes important information about this plasmid. The plasmid and insert names provided here relate only to this library. The name of the ORF (if present) in VACV strain Copenhagen and the name of the ORF (if annotated) in VACV strain WR sequence can be found in VVOrfData spreadsheet. Please note that the amino acid sequence given for each ORF in the spreadsheet may contain some errors. Additionally, changes from the expected sequence may be present in these plasmids. Please see Addgene's quality control sequence and sequencing notes in the VVOrfData spreadsheet before ordering this plasmid.
Proper citation: RRID:Addgene_12751 Copy
Genetic Insert: tse2 toxin
Vector Backbone Description: Vector Backbone:pDS132; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31201277
Proper citation: RRID:Addgene_127451 Copy
Genetic Insert: mqsR toxin
Vector Backbone Description: Vector Backbone:pDS132; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31201277
Proper citation: RRID:Addgene_127450 Copy
Genetic Insert: yhaV toxin
Vector Backbone Description: Vector Backbone:pDS132; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31201277
Proper citation: RRID:Addgene_127455 Copy
Genetic Insert: mqsR toxin
Vector Backbone Description: Vector Backbone:pDS132; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol
Defining Citation: PMID:31201277
Proper citation: RRID:Addgene_127453 Copy
Species: Homo sapiens
Genetic Insert: MCPIP1
Vector Backbone Description: Backbone Size:4714; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21115689
Proper citation: RRID:Addgene_127459 Copy
Vector Backbone Description: Vector Backbone:pLenti (Addgene #86708); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31626775
Comments: Cloning Method: Golden Gate; 3' Cloning Site: aagcaccgactcggtgccac
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_127458 Copy
Genetic Insert: tse2 toxin
Vector Backbone Description: Vector Backbone:pDS132; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
Defining Citation: PMID:31201277
Proper citation: RRID:Addgene_127457 Copy
Species: Rattus norvegicus
Genetic Insert: CREB1
Vector Backbone Description: Backbone Size:4100; Vector Backbone:AAV_pSyn; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31883788
Proper citation: RRID:Addgene_137010 Copy
Species: Synthetic
Genetic Insert: pLexA
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For use in the Greengate system (DOI: 10.1371/journal.pone.0083043, Addgene: Kit # 1000000036) or similar Goldengate-based systems. This plasmid carries a Greengate promoter module with the XVE receiving pLexA promoter for beta-Estradiole induction; very handy for two constructs on one T-DNA; see DOI: 10.1371/journal.pone.0083043.
Proper citation: RRID:Addgene_136961 Copy
Species: Synthetic
Genetic Insert: tandem Tomato
Vector Backbone Description: Vector Backbone:pUC19; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: For use in the Greengate system (DOI: 10.1371/journal.pone.0083043, Addgene: Kit # 1000000036) or similar Goldengate-based systems. This plasmid carries a Greengate N-tag module, containing tdTomato fused to a flexible linker described here DOI: 10.1073/pnas.1406446111.
Proper citation: RRID:Addgene_136964 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
